Skip to main content

The High-Throughput Genomics (HTG) Shared Resource supports the New England BioLabs NEBNext Enzymatic Methyl-seq Kit for whole genome methylation analysis. The NEBNext Enzymatic Methyl-seq Kit presents a sensitive enzyme-based solution for the detection of 5mC and 5hmC at the single base level. The recommended input for library preparation is 10–200 ng of genomic DNA which should be delivered in a volume of 15–50 µL. Following Covaris shearing, the fragmented DNA sample is size selected and a library is constructed containing dual-indexed methylated adapters. This is followed by two enzymatic steps. First, the library is treated with TET2 to oxidize 5mC and 5hmC and protect these modified cytosine residues from deamination. The second step uses APOBEC to deaminate non-methylated cytosine residues. Frequently Asked Questions concerning Methyl-seq library preparation can be reviewed below.

Overview of Methyl-Seq Library Preparation Products

Illumina TruSeq Methyl Capture EPIC Library Prep Kit

Enables the enrichment of 107 Mb of human genomic DNA content that includes 3,340,894 CpG sites, 345,327 WGBS DMRs and 141,527 GenCode Promoters in addition to Open Chromatin sites, TFBs, MEDs, FANTOM5 enhancers, and CTCF ChIP peaks. A recommended input of 500 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized in a four-plex reaction (pool of libraries from four different samples) with a set of biotinylated baits that represent methylation sensitive regions of the genome. 

Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Dual-indexed libraries constructed with the TruSeq Methyl Capture EPIC Library Prep Kit can be sequenced on an Illumina NovaSeq. A minimum of 60 million read-pairs should be sequenced from each library.

Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep Kit

Enables the enrichment of 84 Mb of human genomic DNA content that includes 3.7 million CpGs in addition to GenCode promoters and DMRs. A recommended input of 500–3,000 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized with a set of biotinylated baits that represent methylation sensitive regions of the genome. Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Libraries constructed with the Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep Kit contain a single indexed adapter which performs best on a HiSeq 2500 Paired-End sequence run (2 x 125 bp). A minimum of 60 million read-pairs should be sequenced from each library.

Agilent SureSelect Mouse Methyl-Seq Target Enrichment Library Prep Kit

Enables the enrichment of 109 Mb of mouse genomic DNA content that includes CpGs, GenCode promoters and DMRs. A recommended input of 500–3,000 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized with a set of biotinylated baits that represent methylation sensitive regions of the genome. Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Libraries constructed with the Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep kit contain a single indexed adapter which performs best on a HiSeq 2500 Paired-End sequence run (2 x 125 bp). A minimum of 60 million read-pairs should be sequenced from each library.

Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit

Enables the construction of sequencing libraries for genome-wide differential methylation analysis. The recommended input for library preparation is 1–100 ng of genomic DNA which should be delivered in a volume of 15–30 µL. The Swift Kit is compatible with DNA derived from formalin fixed paraffin embedded (FFPE) tissues in addition to high quality DNA sources. Following Covaris shearing and bisulfite treatment of genomic DNA samples, a short tail is added to the 3’ end of single-stranded DNA molecules that enables the addition of adapters required for sequencing on an Illumina instrument. Cost-effective sequencing of the dual-indexed libraries constructed with the Accel-NGS Methyl-Seq kit can be performed on the Illumina NovaSeq.

Frequently Asked Questions

  1. Can you provide a price estimate for the following Methyl-seq project?
  2. How many sequence reads are recommended for methyl-seq libraries?
  3. What sequences should be used to trim adapters from the sequence reads?
  4. Is a balancer library required for sequencing methyl-seq libraries?
  5. How does the NEBNext Enzymatic Methyl-seq kit detect methylated cytosine?
  6. What quantity of DNA is recommended for library preparation?
  7. What is the average insert size in a methyl-seq library?
  8. How should I purify genomic DNA samples?
  9. Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for DNA extraction?
  10. Are DNA samples purified from formalin fixed paraffin embedded (FFPE) tissues compatible with Methyl-seq library preparation?
  11. How should I purify genomic DNA samples from Formalin Fixed Paraffin Embedded (FFPE) tissues?
  12. Does the HTG Shared Resource provide DNA purification services?
  13. Which buffer should be used to elute genomic DNA sample from the spin column?
  14. How should I store genomic DNA samples?
  15. Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?
  16. How should I measure the concentration of my genomic DNA sample?
  17. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
  18. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
  19. How does the HTG Shared Resource qualify libraries prior to sequencing?
  20. How long will sequencing data from my Methyl-Seq libraries be available for download on the GNomEx server?
  21. Does the HTG Shared Resource provide assistance with analysis of sequence data?

1. Can you provide a price estimate for the following Methyl-seq project?

Example 1: Library Prep and Sequencing of 4 human DNA samples.

  • Library Prep with NEBNext Enzymatic Methyl-seq Kit (includes sample QC, library preparation and library QC/pooling)
  • NovaSeq X 150x150 bp sequencing with 250-300 million read-pairs per sample.
Description Quantity Unit Price Extended Price
NEBNext Enzymatic Methyl-seq Kit 4 $130 $520
NovaSeq X 150x150 Sequencing (1250 M read-pairs per lane) 1 $1,500 $1,500
Total $2,020

Example 2: Library Prep and Sequencing of 1 human DNA samples.

  • Library Prep with NEBNext Ultra II Library Prep Kit (includes sample QC, library preparation and library QC/pooling)
  • NovaSeq X 150x150 bp sequencing with 300 million read-pairs per sample.
Description Quantity Unit Price Extended Price
NEBNext Enzymatic Methyl-seq Kit 1 $130 $130
NovaSeq X 150x150 Sequencing (100 M read-pairs) 3 $180 $540
Total $670

2. How many sequence reads are recommended for methyl-seq libraries?

A minimum of 200–300 million read-pairs on a 150x150 bp sequence run is recommended for human whole methylome libraries constructed with the NEBNext Enzymatic Methyl-seq Kit.

3. What sequences should be used to trim adapters from the sequence reads?

The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the NEBNext Methyl-Seq Library Prep Kit.

  • Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

4. Is a balancer library required for sequencing methyl-seq libraries?

Sequencing of a methyl-seq library on an Illumina instrument requires the representation of all four nucleotides (A, C, G, T) during each cycle of the sequence process. Considering that methyl-seq libraries are substantially depleted of cytosine residues during the first read of sequencing and thymine residues during the paired-end read, a balancer library such as Illumina’s PhiX Control v3 (cat# FC-110-3001) is added to the sequence lane at a molarity that will represent approximately 15% of the reads. The PhiX balancer library enables each nucleotide to have a minimum of 3–5% representation during each cycle of the sequence run which is necessary to provide accurate base calling.

5. How does the NEBNext Enzymatic Methyl-seq kit detect methylated cytosine?

Following the ligation of methylated adaptors, TET2 enzyme is introduced to oxidize 5-mC and 5-hmC residues. This oxidation step protects methylated cytosine from deamination by APOBEC during the subsequent step. In contrast, unmodified cytosines are deaminated to uracil residues which enable their identification by sequencing.

6. What quantity of DNA is recommended for library preparation?

A quantity of 10–200 ng of genomic DNA in a volume of 15–50 µL is recommended for preparing a library with the NEBNext Enzymatic Methyl-Seq Kit. Library construction with a quantity of DNA on the high side of this range will result in a more diverse library whereas smaller quantities of input can result in a higher percent of duplicate reads in the sequence data.

7. What is the average insert size in a methyl-seq library?

A library constructed with the NEBNext Enzymatic Methyl-seq Kit has an average insert size of approximately 300–500 bp.

8. How should I purify genomic DNA samples?

High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504), or from purification kits available from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068), or the Quick-DNA MiniPrep Kit (cat#D3024).

9. Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for DNA extraction?

The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone product for genomic DNA purification is strongly discouraged. The quality of DNA purified with these reagents tend to be lower due to organic carry-over and the co-precipitation of biomolecules which may be inhibitory to downstream enzymatic steps in the library preparation process.

10. Are DNA samples purified from formalin fixed paraffin embedded (FFPE) tissues compatible with Methyl-seq library preparation?

DNA samples purified from FFPE tissues are compatible with the NEB Enzymatic Methyl-Seq kit. However, libraries prepared from FFPE DNA may have higher methylation backgrounds due to modifications that occur during FFPE fixation.

11. How should I purify genomic DNA samples from Formalin Fixed Paraffin Embedded (FFPE) tissues?

The HTG Shared Resource recommends purifying genomic DNA from FFPE tissues using the Promega ReliaPrep FFPE DNA MiniPrep System (cat#A2351) which fully decrosslinks the DNA sample or the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234). Note that FFPE DNA purified with the Qiagen kit may remain substantially crosslinked and therefore will require additional decrosslinking prior to library preparation.

12. Does the HTG Shared Resource provide DNA purification services?

DNA purification services can be obtained from either the Biorepository and Molecular Pathology Shared Resource or the Cellular Translational Research Core Facility.

13. Which buffer should be used to elute genomic DNA sample from the spin column?

Elution buffer contained in Qiagen (Buffer AE) and Zymo Research genomic DNA purification kits (Zymo DNA Elution Buffer) are compatible with the NEBNext Enzymatic Methyl-seq kit.

14. How should I store genomic DNA samples?

Genomic DNA samples should be stored at -80°C. Dilute solutions of DNA should be stored in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute DNA solutions to the surface of the plastic tube.

15. Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?

An A260 measurement on a NanoDrop often reflects absorbance by multiple forms of nucleic acids that are present in a DNA sample. The process of purifying DNA on a spin column frequently yields an end product that includes DNA, RNA, short nucleic acid fragments and nucleotides. Considering that many DNA samples contain 10–90% RNA, this assay often does not accurately reflect the concentration of genomic DNA.

16. How should I measure the concentration of my genomic DNA sample?

The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) when DNA concentrations range from 50–1000 ng/ul or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851) when DNA concentrations range from 0.1–100 ng/ul. Both of these kits use a fluorometric assay to measure double-stranded DNA within a sample.

17. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?

The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856). These reagents can be purchased from Fisher Scientific.

18. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?

Adapter dimer products, which appear as a 120–140 bp band on a DNA ScreenTape Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only sequence reads may be present if libraries are sequenced that contain adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads on patterned flow cells such as those used on the NovaSeq X.

19. How does the HTG Shared Resource qualify libraries prior to sequencing?

Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq or MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the KAPA Library Quantification Kit for Illumina Platforms which is used to normalize the molarity of libraries in preparation for pooling. 

The cost for these quality control assays is included as part of the library preparation cost when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged for library QC on a per sample basis when researchers construct libraries within their own lab.

20. How long will sequencing data from my Methyl-Seq libraries be available for download on the GNomEx server?

Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Cancer Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to mark sequencing data for long-term storage in the cloud. Please contact the Cancer Bioinformatics Shared Resource for information on creating an account if you would like to participate in this long term storage option. Alternatively, researchers can explore other options for data storage but they should be aware that the GNomEx server will only be able to support storage for time period of approximately six months.

21. Does the HTG Shared Resource provide assistance with analysis of sequence data?

The HTG Shared Resource does not provide sequence analysis services. Please contact the Cancer Bioinformatics Shared Resource for assistance with analysis at bioinformaticscore@lists.utah.edu.

Contact Us

High-Throughput Genomics Director
Brian K. Dalley, PhD

High-Throughput Genomics Associate Director
Opal Allen, PhD

Submit Contact Form

Governance

Huntsman Cancer Institute Senior Director Oversight
Aik Choon Tan, PhD

Faculty Advisory Committee Chair
Jason Gertz, PhD

Faculty Advisory Committee Members
Kaitlin Basham, PhD
Allison Carey, MD, PhD
Vaia Florou, MD, MS
James Gagnon, PhD
Kevin Jones, MD
Xiaoyang Zhang, PhD
Xiaoxu Yang, PhD