Skip to main content

Chromatin immunoprecipitation (ChIP) sequencing enables an investigator to define the distribution and abundance of DNA-bound protein targets across the entire genome of an organism. Specific DNA sites that are bound by a protein can be enriched by immunoprecipitation. Following de-crosslinking from the targeted protein, the purified DNA is used to construct a sequencing library. The New England BioLabs NEBNext Ultra II DNA Library Prep Kit enables construction of ChIP-Seq libraries from 0.5-10 ng of input DNA.  Frequently Asked Questions concerning ChIP-Seq library preparation can be reviewed below. 

1. Please provide a price estimate for the following DNA sequencing project.

Example 1: Library Prep 8 ChIP DNA samples with 25 million reads per sample:

  • Library Prep with NEBNext Ultra II Library Prep Kit (includes sample QC, library preparation and library QC/pooling)
  • NovaSeq X 150x150 bp sequencing with 25 million read-pairs per sample 
Description Quantity Unit Price Extended Price
ChIP-Seq with NEBNext Ultra II DNA Library Prep Kit  8  $70  $560 
NovaSeq X 150x150 Sequencing (100 M read-pairs)  2 $150  $300 
Total $860 

Back to Top

2. How many sequence reads are recommended for ChIP-Seq analysis? 

A minimum of 25-50 million read-pairs are recommended for a ChIP-seq library constructed from human or mouse DNA. 

Back to Top

3. What sequences should be used to trim adapters from the sequence reads? 

The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the NEBNext Ultra II DNA Library Prep Kit. 

Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 

Back to Top

4. What quantity of ChIP DNA is recommended for library preparation? 

A quantity of 0.5-10 ng of ChIP DNA is recommended for constructing a library with the NEBNext ChIP-seq Library Prep Kit. If you have less than 1 ng, consider pooling replicate ChIP samples together in a maximum volume of 30 µL. 

Back to Top

5. What is the average insert size of a ChIP-Seq library? 

The average insert size of a ChIP-Seq library constructed with the NEBNext ChIP-Seq Library Prep Kit is approximately 150 to 500 bp.

Back to Top 

6. How should I purify ChIP DNA samples? 

ChIP samples should be purified with a spin column such as those available in the Zymo Research ChIP DNA Clean and Concentrator Kit (cat# D5205) or the Qiagen QIAquick PCR Purification Kit (cat# 28104). 

Back to Top

7. Do you recommend purifying ChIP DNA samples with phenol/chloroform or other organic extraction methods? 

The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone product for DNA purification is strongly discouraged.  The quality of DNA purified with these reagents tend to be lower due to organic carry-over and the co-precipitation of biomolecules which may be inhibitory to downstream enzymatic steps in the library preparation process. 

Back to Top

8. Should I include carrier DNA when purifying my ChIP DNA sample as a means to reduce sample loss? 

Do not use salmon sperm DNA, calf thymus DNA, or other DNA-based carriers at any step in the immunoprecipitation and purification process of ChIP samples. Carrier DNA can function as template during library preparation and will represent a large fraction of the sequence reads that are obtained from a library constructed from a sample that contains carrier nucleic acids. 

Back to Top

9. How should I store dilute ChIP DNA samples? 

ChIP DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute DNA to the surface of the plastic tube. 

Back to Top

10. Is the NanoDrop a good choice for measuring the concentration of a ChIP DNA sample? 

An A260 measurement on a NanoDrop often reflects absorbance by multiple forms of nucleic acids that are present in a sample including both DNA and RNA.  Likewise, because of the low concentration of these samples, the NanoDrop is not a good instrument for measuring ChIP DNA concentrations. 

Back to Top

11. How should I measure the concentration of my ChIP DNA sample? 

The concentration of ChIP DNA samples can be accurately measured using a Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851) which can detect a quantity of DNA as low as 0.1 ng. 

Back to Top

12. Does the HTG Shared Resource provide researchers with access to a Qubit instrument? 

The High Throughput Genomics Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers.  Reagents required to use this instrument for the measurement of DNA concentration includes the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856).  These reagents can be purchased from Fisher Scientific/Thermo Fisher Scientific

Back to Top

13. Could you recommend a positive control antibody that has been validated for chromatin immunoprecipitation? 

Researchers at the University of Utah have used H3K4me3 (Active Motif cat# 39159) and RNA polymerase II (Active Motif cat#61085) as positive control antibodies for ChIP-Seq. 

Back to Top

14. Do you have recommendations for formaldehyde crosslinking? 

The concentration and incubation time of formaldehyde should be optimized by the user. As an initial guideline, a concentration of 1% formaldehyde for 5-15 minutes is common. We recommend the purchase of 16% formaldehyde solution in single-use ampules such as that manufactured by Pierce (Fisher cat# 28906). 

Back to Top

15. What instruments are recommended for chromatin fragmentation? 

Researchers at the University of Utah have successfully used the following sonifiers for ChIP-seq experiments: Branson Ultrasonics Sonifier S450, Diagenode Bioruptor Pico, and Active Motif EpiShear Probe Sonicator. Investigators should aim for a majority of their crosslinked chromatin fragments to be in the 200-600 bp size range while ensuring the integrity of the protein that will be targeted for immunoprecipitation. Fragmentation should initially be performed as a time series to identify optimal time and power settings through analysis of fragmented chromatin by agarose gel electrophoresis. The researcher should also define an optimal concentration of cells for shearing and follow that standard in each experiment. Variations in the quantity of cells can affect the efficiency of the shearing process. 

Back to Top

16. Should I be concerned if adapter dimer products are present in the ChIP-seq library that I constructed? 

Adapter dimer products, which appear as 120 to 150 bp bands on an Agilent DNA ScreenTape Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts.  The researcher should be aware that a substantially disproportionate quantity of adapter-only reads may be present in sequence data derived from libraries containing adapter-dimer products.

Back to Top

17. How long will sequencing data from my ChIP-seq libraries be available for download on the GNomEx server? 

Sequencing data will be available on the GNomEx server for a period of approximately 3 to 6 months. The Cancer Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to mark sequencing data for long-term storage in the cloud. Please contact the Cancer Bioinformatics Shared Resource for information on creating an account if you would like to participate in this long-term storage option. Alternatively, researchers can explore other options for data storage but they should be aware that the GNomEx server will only be able to support storage for a time period of approximately six months. 

Back to Top

18. Does the HTG Shared Resource provide assistance with analysis of sequence data? 

The High Throughput Genomics Shared Resource does not provide sequence analysis services. Please contact the Cancer Bioinformatics Shared Resource at the Huntsman Cancer Institute for assistance with analysis.

Back to Top

Contact Us

High-Throughput Genomics Director
Brian K. Dalley, PhD

High-Throughput Genomics Associate Director
Opal Allen, PhD

Submit Contact Form

Governance

HCI Senior Director Oversight
Alana Welm, PhD

Faculty Advisory Committee Chair
Katherine Varley, PhD

Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD