HTG ChIP Sequencing

What quantity of ChIP DNA is recommended for library preparation?

A quantity of 1-10 ng of ChIP DNA is recommended for constructing a library with the NEBNext ChIP-seq Library Prep Kit. If you have less than 1 ng, consider pooling replicate ChIP samples together in a maximum volume of 30 µL.

How should I purify ChIP DNA samples?

ChIP samples should be purified with a spin column such as those available in the Zymo Research ChIP DNA Clean and Concentrator Kit (cat# D5205) or the Qiagen QIAquick PCR Purification Kit (cat# 28104).

Do you recommend purifying ChIP DNA samples with phenol/chloroform or other organic extraction methods?

The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone protocol for ChIP DNA purification is strongly discouraged. The quality of DNA purified by these protocols tend to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process. Ultra-low input ChIP DNA samples can be particularly compromised by these impurities.

How should I store dilute genomic DNA samples?

ChIP DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute DNA solutions to the surface of the plastic tube.

Is the NanoDrop a good choice for measuring the concentration of a ChIP DNA sample?

An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid (DNA, RNA, short nucleic acid fragments, or nucleotides) and therefore this assay often does not accurately reflect the concentration of sample of purified genomic DNA which may contain other forms of nucleic acids.

How should I measure the concentration of my ChIP DNA sample?

The concentration of ChIP DNA samples can be accurately measured using a Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851).

Does the HTG Shared Resource provide researchers with access to a Qubit instrument?

The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of ChIP DNA concentration include the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856).

Should I include carrier DNA when purifying my ChIP DNA sample as a means to reduce sample loss?

Do not use salmon sperm DNA, calf thymus DNA, or other DNA-based carriers at any step in the immunoprecipitation and purification process of ChIP samples. Carrier DNA can function as template during library preparation and will substantially contribute to the volume of sequence reads obtained from a library constructed from a sample containing carrier nucleic acids.

Could you recommend a positive control antibody that has been validated for chromatin immunoprecipitation?

Researchers at the University of Utah have used H3K4me3 (Active Motif cat# 39159) and RNA polymerase II (Active Motif cat#61085) as positive control antibodies for ChIP-Seq.

Do you have recommendations for formaldehyde crosslinking?

The concentration and incubation time of formaldehyde should be optimized by the user. As an initial guideline, a concentration of 1% formaldehyde for 5-15 minutes is common. We recommend the purchase of 16% formaldehyde solution in single-use ampules such as that manufactured by Pierce (Fisher cat# 28906).

What instruments are recommended for chromatin fragmentation?

Researchers at the University of Utah have successfully used the following sonifiers for ChIP-seq experiments: Branson Ultrasonics Sonifier S450, Diagenode Bioruptor Pico, and Active Motif EpiShear Probe Sonicator. Investigators should aim for a majority of their crosslinked chromatin fragments to be in the 200-600 bp size range while ensuring the integrity of the protein that will be targeted for immunoprecipitation. Fragmentation should initially be performed as a time series to identify optimal time and power settings through analysis of fragmented chromatin by agarose gel electrophoresis. The researcher should also define an optimal concentration of cells for shearing and follow that standard in each experiment. Variations in the quantity of cells can affect the efficiency of the shearing process.

What is the average insert size of a ChIP-Seq library?

The average insert size of a ChIP-Seq library constructed with the NEBNext ChIP-Seq Library Prep Kit is approximately 300 to 500 bp.

How many sequence reads are recommended for ChIP-Seq analysis?

A minimum of 25-50 million read-pairs are recommended for ChIP-seq libraries.

What sequences should be used to trim adapters from the sequence reads?

The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the NEBNext ChIP-Seq Library Prep Kit:

• Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
• Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

How long will sequencing data from my ChIP-seq libraries be available for download on the GNomEx server?

Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Seven Bridges for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Seven Bridges. Otherwise, researchers can explore other options for data storage but they should be aware that the GNomEx server is unable to support a solution in excess of six months.

Does the HTG Shared Resource provide assistance with analysis of sequence data?

The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.