The High-Throughput Genomics (HTG) Shared Resource supports whole genome sequencing on the Illumina platform enabling diverse levels of sequencing outputs and run types to support a cost-effective solution for various scales and types of projects. An overview of the library preparation kits supported for DNA sequencing and answers to Frequently Asked Questions are provided below.
Overview of DNA Library Preparation Kits
NEBNext Ultra II DNA Library Prep Kit
The New England Biolabs NEBNext Ultra II DNA Library Prep Kit enables the construction of genomic DNA libraries with minimal pcr amplification. Following mechanical shearing of the DNA sample, libraries are constructed with UMI adaptors that result in an average insert size of approximately 300-700 bp. This kit is also used for constructing libraries from DNA samples extracted from FFPE tissues. The recommended input for library construction is 10–200 ng of DNA which should be delivered in a volume of 15–50 µl.
NEBNext Ultra II DNA Library Prep Kit: PCR-free
The New England Biolabs NEBNext Ultra II DNA Library Prep Kit also enables construction of pcr-free libraries when higher input quantities of genomic DNA are available. Following mechanical shearing of the DNA sample, libraries are constructed with UMI adaptors that result in an average insert size of approximately 300–700 bp. The recommended input for library construction is 200–1000 ng of DNA which should be delivered in a volume of 15–50 µl.
IDT xGen cfDNA Library Prep
The IDT xGen cfDNA Library Prep kit is used to construct sequencing libraries from cfDNA samples and from germline controls (the latter being mechanically sheared to a size range similar to cfDNA). Libraries are constructed with UMI adaptors and minimal pcr amplification yielding an average insert size of approximately 170 bp. The recommended input for library construction is 1–20 ng of cfDNA which should be delivered in a volume of 15–40 ul.
Illumina DNA Prep
The Illumina DNA Prep kit uses tagmentation technology for the construction of genomic DNA sequencing libraries with an average insert size of approximately 300–600 bp and minimal pcr amplification. The recommended input for library construction is 10–200 ng of DNA which should be delivered in a volume of 15–30 ul.
Illumina DNA Prep for Small Genomes
The HTG Shared Resource offers a reduced price for library preparation of DNA samples from organisms with a small genome (less than 1 Gbp). Using the Illumina DNA Prep Kit, tagmentation technology is used to construct genomic DNA libraries with an average insert size of approximately 300–600 bp. The recommended input for library construction is 1–25 ng of DNA which should be delivered in a volume of 10–15 ul. The Small Genomes library option is only available for orders consisting of 16 or more samples.
NEBNext Ultra II FS DNA Library Prep for Small Genomes
An alternative option for library prep of samples with a small genome (less than 1 Gbp) is the NEBNext Ultra II FS DNA Library Prep. Using the NEB FS DNA Library Prep kit, samples are enzymatically fragmented during a step that simultaneously performs end repair of the DNA fragments. This kit is used to construct genomic DNA libraries with an average insert size of approximately 200–500 bp. The recommended input for library construction is 1–25 ng of DNA which should be delivered in a volume of 10–15 ul. The Small Genomes library option is only available for orders consisting of 16 or more samples.
Frequently Asked Questions
- Can you provide a price estimate for the following DNA sequencing project?
- How many sequence reads are recommended for human whole genome sequencing?
- What sequences should be used to trim adapters from the sequence reads?
- Describe the unique molecular identifiers (UMI) used in the construction of NEB libraries
- Describe the unique molecular identifiers (UMI) used in the construction of IDT cfDNA libraries.
- How does the HTG Shared Resource qualify libraries prior to sequencing?
- What quantity of DNA is recommended for library preparation?
- How many copies of a haploid human genome are represented in 1 ng of genomic DNA?
- How does the Illumina DNA Prep for Small Genomes protocol differ from the standard Illumina DNA Prep protocol?
- How does the Illumina DNA Prep for Small Genomes differ from the NEBNext Ultra II FS DNA Library Prep for Small Genomes?
- What is the average insert size of a DNA library?
- How should I purify genomic DNA samples?
- How should I purify genomic DNA samples from FFPE tissues?
- Does the HTG Shared Resource provide DNA purification services?
- Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?
- Is DNA that has been purified from FFPE tissues compatible with library preparation?
- Describe the methods used for FFPE repair?
- Which buffer should be used to elute genomic DNA samples from a spin column?
- How should I concentrate my DNA samples?
- How should I store dilute genomic DNA samples?
- Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?
- How should I measure the concentration of my DNA samples?
- Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
- Can I construct my own libraries for sequence analysis on an Illumina instrument?
- Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
- How long will my sequencing data be available for download on the GNomEx server?
- Does the HTG Shared Resource provide assistance with analysis of sequence data?
Example 1: Whole Genome Sequencing of 4 human DNA samples (300 Million reads per sample)
- Library Prep with NEBNext Ultra II Library Prep Kit (includes sample QC, library preparation and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 300 million read-pairs (90 Gb) per sample
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| NEBNext Ultra II DNA Library Prep Kit | 4 | $90 | $360 |
| NovaSeq X 150x150 Sequencing (1250 M read-pairs/lane) | 1 | $1500 | $1500 |
| Total | $1,860 | ||
Example 2: Whole Genome Sequencing of 20 yeast DNA samples
- Library Prep with Illumina DNA Prep for Small Genomes (includes sample QC, library prep and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 5 million read-pairs per sample (100 million total reads)
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| Illumina DNA Prep for Small Genomes | 20 | $40 | $800 |
| NovaSeq X 150x150 Sequencing (100 M read-pairs) | 1 | $180 | $180 |
| Total | $980 | ||
3. What sequences should be used to trim adapters from the sequence reads?
NEBNext Ultra II DNA Library Prep: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the NEBNext Ultra II DNA Library Prep Kit.
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Illumina DNA Prep: The following sequences can be used for trimming adapters from the 3’ end of sequence reads in both Read 1 and Read 2 for libraries constructed with the Illumina DNA Prep kit.
- Read 1 and Read 2: CTGTCTCTTATACACATCT
4. Describe the unique molecular identifiers (UMI) used in the construction of NEB libraries
Libraries constructed with the NEBNext Ultra II DNA Library Prep Kit are constructed with UMI adaptors. The unique molecular identifier consists of an 11 base sequence that is located 3’ to the i7 index and is sequenced during the i7 index read. This sequence enables more accurate removal of duplicate reads and error correction through consensus sequence building.
Sequence data containing a UMI read in a NEB library will be recorded as Read 2 in the FASTQ files, with the forward and reverse data reads being reported as Read 1 and Read 3, respectively. In addition to UMIs, libraries constructed with the NEB Ultra II DNA library prep kit also include unique dual index adapters for demultiplexing of sequence reads.
5. Describe the unique molecular identifiers (UMI) used in the construction of IDT cfDNA libraries.
Libraries constructed with the IDT xGen cfDNA Library Prep Kit contain inline 8 bp UMIs that are sequenced at the beginning of read 1 and of read 2. The UMIs in the IDT kit consist of 32 fixed-sequence identifiers that enable more accurate removal of duplicate reads and error correction. In addition to UMIs, libraries constructed with the IDT xGen cfDNA library prep kit also include unique dual index adapters for demultiplexing of sequence reads.
6. How does the HTG Shared Resource qualify libraries prior to sequencing?
Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq X. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent DNA ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit to calculate and normalize the molarity of individual libraries when preparing library pools to apply to a NovaSeq X flow cell.
The cost for these quality control assays is included as part of library preparation when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample (or pre-pooled sample) when researchers construct libraries within their own lab.
7. What quantity of DNA is recommended for library preparation?
NEBNext Ultra II DNA Library Prep Kit: A quantity of 10–200 ng of genomic DNA in a volume of 10–50 ul is recommended for constructing a genomic DNA library with the NEBNext Ultra II DNA Library Prep Kit. Library construction with higher quantities of DNA input will result in a more diverse library whereas smaller quantities or low-quality genomic DNA samples can result in a higher percent of duplicate reads in the sequence data.
NEBNext Ultra II DNA Library Prep Kit: PCR-free A quantity of 200–1000 ng of high-quality genomic DNA in a volume of 10–50 ul is recommended for constructing a pcr-free library with the NEBNext Ultra II DNA Library Prep Kit.
IDT xGen cfDNA Library Prep Kit: A quantity of 1–20 ng of cfDNA in a volume of 10–40 ul is recommended for constructing a library with the IDT xGEN cfDNA Library Prep kit.
Illumina DNA Prep: A quantity of 10–200 ng in a volume of 10–30 ul is recommended for constructing a genomic DNA library with the Illumina DNA Prep kit.
Illumina DNA Prep for Small Genomes: A quantity of 1–25 ng in a volume of 10–15 ul is recommended for constructing a genomic DNA library with the Illumina DNA Prep kit when working with samples with a genome smaller than 1 Gbp.
NEBNext Ultra II FS DNA Library Prep Kit for Small Genomes: A quantity of 1–25 ng in a volume of 10–15 ul is recommended for constructing a genomic DNA library with the NEBNext Ultra II FS DNA Library Prep kit when working with samples with a genome smaller than 1 Gbp.
9. How does the Illumina DNA Prep for Small Genomes protocol differ from the standard Illumina DNA Prep protocol?
The Illumina DNA Prep for Small Genomes has been designed to provide a diverse sequencing library for DNA samples derived from organisms with genomes smaller than 1 Gbp by reducing the reaction size during library prep in addition to the quantity of input DNA. The Small Genomes library option is only available for orders consisting of 16 or more samples.
10. How does the Illumina DNA Prep for Small Genomes differ from the NEBNext Ultra II FS DNA Library Prep for Small Genomes?
The Illumina DNA Prep works best with high quality DNA samples of high MW that have been purified using a spin column and that do not contain EDTA. This prep has good control of size selection with an insert size that ranges from 300–600 bp. The NEBNext FS DNA prep for Small Genomes can work with lower quality samples that are highly fragmented in addition to high quality DNA purified on spin columns. However, when preparing samples that are purified by diverse lab groups, we notice a higher variability of insert size distribution when using the NEB FS DNA kit. Size distribution can be more severely influenced by purity of the sample and the quantity of input DNA.
11. What is the average insert size of a DNA library?
NEBNext Ultra II DNA Library Prep Kit (all): Genomic DNA is mechanically sheared and size selected to an average size of 300–700 bp when constructing libraries with the NEBNext Ultra II DNA Library Prep Kit. However, the use of this kit for construction of libraries from DNA samples purified from FFPE tissues tends to result in a reduced insert size (100–400).
Illumina DNA Prep (all): The average insert size of a library constructed with the Illumina DNA Prep kit is approximately 300–600 bp. This kit is not compatible with custom size selection.
12. How should I purify genomic DNA samples?
High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504) or one of the purification kits from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068) or the Quick-DNA MiniPrep Kit (cat#D3024).
13. How should I purify genomic DNA samples from FFPE tissues?
The HTG Shared Resource recommends purifying genomic DNA from FFPE tissues using the Promega ReliaPrep FFPE DNA MiniPrep System (cat#A2351) which uses a protocol to fully decrosslink the DNA or alternatively, one can use the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234). Note that the Qiagen kit will only partially de-crosslink your DNA samples which can result in lower diversity of the resultant sequencing library.
14. Does the HTG Shared Resource provide DNA purification services?
DNA purification services can be obtained from either the Biorepository and Molecular Pathology Shared Resource or the Cellular Translational Research Core Facility.
15. Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?
DNA Genotek, manufacturer of the Oragene line of products for genomic DNA purification from saliva, documents that genomic DNA samples purified from human saliva can routinely contain 2–40% bacterial DNA. In contrast, bacterial DNA contribution from buccal swabs (66%) and cytobrushes (88%) is even higher. Therefore, a research lab that plans to use saliva as a source for genomic DNA extraction should also plan to sequence the resulting libraries at a higher read-depth as a means to achieve adequate coverage of the human genome fraction in a library that contains a background of bacterial DNA.
16. Is DNA that has been purified from FFPE tissues compatible with library preparation?
DNA extracted from FFPE tissues is compatible with the NEBNext Ultra II DNA Library Prep Kit following full decrosslinking and FFPE repair. However, DNA extracted from FFPE tissues is not compatible with pcr-free library protocols. Higher quantities of input DNA may be required for constructing libraries from FFPE samples.
17. Describe the methods used for FFPE repair?
DNA extracted from FFPE tissues frequently remains partially crosslinked which can inhibit efficient library preparation. Therefore, these samples are treated with an additional de-crosslinking protocol which is followed by treatment with the New England Biolabs NEBNext FFPE DNA Repair Mix v2 (cat#E7360). The FFPE Repair Mix is a cocktail of enzymes that includes activities to seal DNA nicks, fill in 5’ over-hangs, polish 3’ ends to a hydroxyl group, fill in short single-stranded DNA gaps of 5-10 bases, and removal and replacement of nucleotides at abasic sites. FFPE repair prior to library preparation is available for an additional fee.
18. Which buffer should be used to elute genomic DNA samples from a spin column?
Elution buffers included for DNA extraction with the Qiagen and Zymo Research consist of Qiagen Buffer AE (10 mM Tris-HCl, 0.5 mM EDTA, pH 9.0) and Zymo Research DNA Elution Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.5), respectively. We recommend low levels of EDTA (0.1 mM or lower) when library preparation is performed with the Illumina DNA Prep kit as the tagmentation enzyme is sensitive to EDTA and library prep has been observed to experience a 10–20% lower yield when prepping DNA samples provided with higher levels of EDTA.
Alternatively, one can substitute either Qiagen Buffer EB (cat# 19086) which is composed of 10 mM Tris pH 8.5 or a low-EDTA buffer such as Teknova DNA Suspension Buffer (cat#T0223) which is composed of 10 mM Tris, 0.1 mM EDTA, pH 8.0 when eluting DNA samples from a spin column.
20. How should I store dilute genomic DNA samples?
Dilute genomic DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C). Both of these products minimize the non-specific binding of DNA to the surface of the plastic tube.
21. Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?
An A260 measurement on a NanoDrop often reflects absorbance by multiple forms of nucleic acids that are present in a DNA sample. The process of purifying DNA on a spin column frequently yields an end product that includes DNA, RNA, short nucleic acid fragments and nucleotides. Considering that many DNA samples contain 10–90% RNA, this assay often does not accurately reflect the concentration of genomic DNA.
22. How should I measure the concentration of my DNA samples?
The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) when DNA concentrations range from 50–1000 ng/ul or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851) when DNA concentrations range from 0.1–100 ng/ul. Both of these kits use a fluorometric assay to measure double-stranded DNA within a sample.
23. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856). These reagents can be purchased from Fisher Scientific.
24. Can I construct my own libraries for sequence analysis on an Illumina instrument?
Although the HTG Shared Resource offers support for all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing these libraries, quality control assays will be performed including a Qubit dsDNA HS Assay (library concentration), Agilent DNA ScreenTape Assay (size distribution), and qPCR using the KAPA Library Quantification Kit to normalize the molarity of libraries in preparation for sequencing.
25. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
Adapter dimer products, which typically appear as 120–140 bp bands on an Agilent DNA ScreenTape Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain a DNA insert. A library that is represented by 5% adapter dimer may be expected to yield as much as 60% adapter-only sequence reads. It is important for researchers that construct their own sequencing libraries to properly measure the quantity of DNA (or RNA) going into library prep and to select against the presence of adapter dimers when purifying the pcr-amplified library.
26. How long will my sequencing data be available for download on the GNomEx server?
Sequencing data will be available on the GNomEx server for a period of approximately six months. The Cancer Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to mark sequencing data for long-term storage in the cloud. Please contact the Cancer Bioinformatics Shared Resource for information on creating an account if you would like to participate in this long term storage option. Alternatively, researchers can explore other options for data storage but they should be aware that the GNomEx server will only be able to support storage for time period of approximately six months.
27. Does the HTG Shared Resource provide assistance with analysis of sequence data?
The HTG Shared Resource does not provide sequence analysis services. Please contact the Cancer Bioinformatics Shared Resource for assistance with analysis at bioinformaticscore@lists.utah.edu.
Contact Us
High-Throughput Genomics Director
Brian K. Dalley, PhD
High-Throughput Genomics Associate Director
Opal Allen, PhD
Governance
HCI Senior Director Oversight
Alana Welm, PhD
Faculty Advisory Committee Chair
Katherine Varley, PhD
Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD