The High Throughput Genomics Shared Resource supports whole genome sequencing on the Illumina platform enabling diverse levels of sequencing outputs and run types to support a cost-effective solution for various scales and types of projects. An overview of the library preparation kits supported for DNA sequencing and answers to Frequently Asked Questions are provided below:
Overview of DNA Library Preparation Kits
NEBNext Ultra II FS DNA Library Prep:
The New England Biolabs NEBNext Ultra II FS DNA Library Prep Kit enables the construction of either pcr-free DNA libraries or libraries with minimal pcr amplification. Using the NEBNext FS DNA Library Prep kit, samples are enzymatically fragmented while simultaneously performing end repair/A-tailing of the DNA fragments. This kit is used to construct genomic DNA libraries with an average insert size of approximately 300 to 600 bp. The recommended input for library construction is 200 to 500 ng of DNA for pcr-free libraries and 10 to 100 ng of DNA for pcr-amplified. Genomic DNA should be delivered in a volume of 15 to 25 ul.
NEBNext Ultra II FS DNA Library Prep for CNV Analysis:
An option for low depth sequencing for CNV analysis is available using the New England Biolabs NEBNext Ultra II FS DNA Library Prep Kit. Samples are enzymatically fragmented to initiate preparation of a low input pcr-free library with an average size distribution of 300 to 600 bp. The recommended input for library construction for CNV analysis is 25 to 100 ng of genomic DNA in a volume of 10 to 15 ul.
NEBNext Ultra II DNA PCR-free Library Prep Kit:
The New England Biolabs NEBNext Ultra II DNA Library Prep Kit enables construction of pcr-free libraries when higher input quantities of genomic DNA are available. DNA samples are mechanically sheared using Covaris AFA technology. Size selected DNA fragments (300-700 bp) are used to construct pcr-free libraries with the NEBNext Ultra II DNA library prep kit. The recommended input for library construction is 200 to 1000 ng of DNA which should be delivered in a volume of 15 to 50 µl.
IDT xGen cfDNA Library Prep:
The IDT xGen cfDNA Library Prep kit is used to construct sequencing libraries from cfDNA. Libraries are constructed with UMI adapters and minimal pcr amplification yielding an average insert size of approximately 170 bp. The recommended input for library construction is 1 to 20 ng of cfDNA which should be delivered in a volume of 15 to 40 ul.
NEBNext Ultra II FS DNA Library Prep for Small Genomes:
An alternative option for library prep of samples with a small genome (less than 1 Gbp) is the NEBNext Ultra II FS DNA Library Prep. Using the NEB FS DNA Library Prep kit, samples are enzymatically fragmented during a step that simultaneously performs end repair of the DNA fragments. This kit is used to construct genomic DNA libraries with an average insert size of approximately 200 to 500 bp. The recommended input for library construction is 1 to 10 ng of DNA which should be delivered in a volume of 10 to 15 ul. The Small Genomes library option is only available for orders consisting of 16 or more samples.
Frequently Asked Questions
- Please provide a price estimate for the following DNA sequencing project.
- How many sequence reads are recommended for human whole genome sequencing?
- What sequences should be used to trim adapters from the sequence reads?
- Describe the unique molecular identifiers (UMI) used in the construction of IDT cfDNA libraries.
- How does the High Throughput Genomics Shared Resource qualify libraries prior to sequencing?
- What quantity of DNA is recommended for library preparation?
- How many copies of a haploid human genome are represented in 1 ng of genomic DNA?
- How does the NEBNext Ultra II FS DNA Library Prep for Small Genomes protocol differ from the standard NEBNext Ultra II FS DNA Library Prep protocol?
- What is the average insert size of a DNA library?
- How should I purify genomic DNA samples?
- How should I purify genomic DNA samples from FFPE tissues?
- Does the High Throughput Genomics Shared Resource provide DNA purification services?
- Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?
- Is DNA that has been purified from FFPE tissues compatible with library preparation?
- Describe the methods used for FFPE repair?
- How many sequence reads are recommended for CNV analysis?
- Which buffer should be used to elute genomic DNA samples from a spin column?
- How should I concentrate my DNA samples?
- Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?
- How should I measure the concentration of my DNA samples?
- Does the High Throughput Genomics Shared Resource provide researchers with access to a Qubit instrument?
- Can I construct my own libraries for sequence analysis on an Illumina instrument?
- Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
- How long will my sequencing data be available for download on the GNomEx server?
- Does the HTG Shared Resource provide assistance with analysis of sequence data?
1. Please provide a price estimate for the following DNA sequencing project.
Example 1: Whole Genome Sequencing of 4 human DNA samples (300 million read-pairs per sample).
- Library Prep with NEBNext Ultra II FS DNA PCR-Free Library Prep Kit: (includes sample QC, library preparation and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 300 million read-pairs (90 Gb) per sample
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| NEBNext Ultra II FS DNA PCR-Free Library Prep Kit | 4 | $75 | $300 |
| NovaSeq X 150x150 Sequencing (1250 M read-pairs/lane) | 1 | $1250 | $1250 |
| Total | $1,550 | ||
Example 2: Whole Genome Sequencing of 20 C. elegans DNA samples
- Library Prep with Illumina DNA Prep for Small Genomes (includes sample QC, library prep and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 10 million read-pairs per sample (200 million total read-pairs)
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| NEBNext Ultra II FS DNA Library Prep for Small Genomes | 20 | $40 | $800 |
| NovaSeq X 150x150 Sequencing (100 M read-pairs) | 2 | $150 | $300 |
| Total | $1,100 | ||
2. How many sequence reads are recommended for human whole genome sequencing?
A quantity of 300 million read-pairs on a 150 x 150 bp sequence run will deliver 90 Gb of sequence data which represents approximately 30x coverage of the human genome.
3. What sequences should be used to trim adapters from the sequence reads?
NEBNext DNA Library Prep Kits: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the NEBNext Ultra II DNA Library Prep Kit.
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
IDT xGen cfDNA Library Prep: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the IDT xGen cfDNA Library Prep. Note that an additional 8 bp of UMI sequence will be present immediately adjacent to the Read 1 and Read 2 adapters.
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Illumina DNA Prep: The following sequences can be used for trimming adapters from the 3’ end of sequence reads in both Read 1 and Read 2 for libraries constructed with the Illumina DNA Prep kit:
- Read 1 and Read 2: CTGTCTCTTATACACATCT
4. Describe the unique molecular identifiers (UMI) used in the construction of IDT cfDNA libraries.
Libraries constructed with the IDT xGen cfDNA Library Prep Kit contain inline 8 bp UMIs that are sequenced at the beginning of read 1 and the beginning of read 2. The UMIs in the IDT kit consists of 32 fixed-sequence identifiers that enable more accurate removal of duplicate reads and error correction. In addition to UMIs, libraries constructed with the IDT xGen cfDNA Library Prep Kit also include unique dual index adapters for improved accuracy in demultiplexing of sequence reads.
5. How does the High Throughput Genomics Shared Resource qualify libraries prior to sequencing?
Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq X. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent DNA ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit to calculate and normalize the molarity of individual libraries in preparation for sequencing. The cost for these quality control assays is included as part of the library preparation cost when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample (or pre-pooled sample) when researchers construct libraries within their own lab.
6. What quantity of DNA is recommended for library preparation?
NEBNext Ultra II FS DNA Library Prep Kit: A quantity of 10 to 100 ng of genomic DNA in a volume of 10-20 ul is recommended for constructing a genomic DNA library with the NEBNext Ultra II FS DNA Library Prep Kit.
NEBNext Ultra II FS DNA PCR-Free Library Prep Kit: A quantity of 200 to 500 ng of genomic DNA in a volume of 15-25 ul is recommended for constructing a genomic DNA library with the NEBNext Ultra II FS DNA PCR-free Library Prep Kit.
NEBNext Ultra II FS DNA Library Prep for CNV Analysis: A quantity of 25 to 100 ng of genomic DNA in a volume of 10-15 ul is recommended for constructing a DNA library for CNV analysis with the NEBNext Ultra II FS DNA Library Prep Kit.
NEBNext Ultra II DNA Library Prep Kit: PCR-free A quantity of 200 to 1000 ng of high-quality genomic DNA in a volume of 15-50 ul is recommended for constructing a pcr-free library with the NEBNext Ultra II DNA Library Prep Kit.
IDT xGen cfDNA Library Prep Kit: A quantity of 1 to 20 ng of cfDNA in a volume of 10-40 ul is recommended for constructing a cell free DNA library with the IDT xGen cfDNA Library Prep kit.
Illumina DNA PCR-Free Prep: A quantity of 50 to 500 ng in a volume of 15-30 ul is recommended for constructing a genomic DNA library with the Illumina DNA PCR-Free Prep.
NEBNext Ultra II FS DNA Library Prep Kit for Small Genomes: A quantity of 1 to 10 ng in a volume of 10-15 ul is recommended for constructing a genomic DNA library with the NEBNext Ultra II FS DNA Library Prep kit when working with samples with a genome smaller than 1 Gbp.
7. How many copies of a haploid human genome are represented in 1 ng of genomic DNA?
One ng of human genomic DNA contains approximately 290 haploid copies of the genome.
8. How does the NEBNext Ultra II FS DNA Library Prep for Small Genomes protocol differ from the standard NEBNext Ultra II FS DNA Library Prep protocol?
The Small Genomes Prep has been designed to provide a diverse sequencing library for DNA samples derived from organisms with genomes smaller than 1 Gbp by reducing the input DNA and the reaction size during library prep. The small genome library prep also has a lower level of quality control for normalizing libraries. The Small Genomes library option is only available for orders consisting of 16 or more samples.
9. What is the average insert size of a DNA library?
NEBNext Ultra II DNA Libraries (all): Fragmented DNA is size selected to yield an average insert size of 300 to 700 bp when constructing libraries with NEBNext Ultra II DNA Kits. However, libraries constructed from DNA samples purified from FFPE tissues are frequently observed to yield a shorter insert size (150-400 bp).
Illumina DNA PCR-Free Prep): The average insert size of a library constructed with the Illumina DNA PCR-Free Prep is approximately 300 to 800 bp. This kit is not compatible with custom size selection.
10. How should I purify genomic DNA samples?
High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504) or one of the purification kits from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068) or the Quick-DNA MiniPrep Kit (cat#D3024).
11. How should I purify genomic DNA samples from FFPE tissues?
The High Throughput Genomics Shared Resource recommends purifying genomic DNA from FFPE tissues using the Promega ReliaPrep FFPE DNA MiniPrep System (cat#A2351) which uses a protocol to fully decrosslink the DNA or alternatively, one can use the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234). Note that the Qiagen kit will only partially de-crosslink your DNA samples which can result in lower diversity of the resultant sequencing library.
12. Does the High Throughput Genomics Shared Resource provide DNA purification services?
DNA purification services can be obtained from either the Biorepository and Molecular Pathology Shared Resource at the Huntsman Cancer Institute or the Cellular Translational Research Core (CTRC).
13. Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?
DNA Genotek, manufacturer of the Oragene line of products for genomic DNA purification from saliva, documents that genomic DNA samples purified from human saliva can routinely contain 2 to 40% bacterial DNA. In contrast, bacterial DNA contribution from buccal swabs (66%) and cytobrushes (88%) is even higher. Therefore, a research lab that plans to use saliva as a source for genomic DNA extraction may want to consider sequencing the libraries at a at a higher read-depth to achieve desired coverage of the human genome fraction in a library that contains a background of bacterial DNA.
14. Is DNA that has been purified from FFPE tissues compatible with library preparation?
DNA extracted from FFPE tissues is compatible with the NEBNext Ultra II DNA Library Prep Kit following full decrosslinking and FFPE repair. However, DNA extracted from FFPE tissues is not compatible with pcr-free library prep protocols. Higher quantities of input DNA may be required for constructing libraries from FFPE DNA samples.
15. Describe the methods used for FFPE repair?
DNA extracted from FFPE tissues frequently remains partially crosslinked which can inhibit efficient library preparation. Therefore, these samples are treated with an additional de-crosslinking protocol which is followed by treatment with the New England Biolabs NEBNext FFPE DNA Repair Mix v2 Module (cat#E7360). The FFPE Repair Mix is a cocktail of enzymes that includes activities to seal DNA nicks, fill in 5’ over-hangs, polish 3’ ends to a hydroxyl group, fill in short single-stranded DNA gaps of 5-10 bases, and removal and replacement of nucleotides at abasic sites.
16. How many sequence reads are recommended for CNV analysis?
The NEBNext Ultra II FS DNA library prep offering for CNV analysis is a low input, pcr-free library. We recommend 60 million read-pairs per sample for CNV analysis.
17. Which buffer should be used to elute genomic DNA samples from a spin column?
Elution buffers included for DNA extraction with the Qiagen and Zymo Research consist of Qiagen Buffer AE (10 mM Tris-HCl, 0.5 mM EDTA, pH 9.0) and Zymo Research DNA Elution Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.5), respectively. We recommend low levels of EDTA (0.1 mM or lower) when library preparation is performed with the Illumina DNA Prep kit as the tagmentation enzyme is sensitive to EDTA and library prep has been observed to experience a 10-20% lower yield when prepping DNA samples provided with higher levels of EDTA. Alternatively, one can substitute either Qiagen Buffer EB (cat# 19086) which is composed of 10 mM Tris pH 8.5 or a low-EDTA buffer such as Teknova DNA Suspension Buffer (cat#T0223) which is composed of 10 mM Tris, 0.1 mM EDTA, pH 8.0 when eluting DNA samples from a spin column.
18. How should I concentrate my DNA samples?
DNA can be concentrated using a Genomic DNA Clean and Concentrator Kit (cat# D4010) from Zymo Research. This kit enables purification and concentration of up to 10 µg of high molecular weight DNA and elution in a volume as low as 10 µl. Alternatively, genomic DNA can be concentrated in a speed-vac with low heat setting.
19. Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?
An A260 measurement on a NanoDrop often reflects absorbance by multiple forms of nucleic acids that are present in a DNA sample. The process of purifying DNA on a spin column frequently yields a product that includes both DNA and RNA. Considering that many DNA samples contain 10 to 90% RNA, this assay often does not accurately reflect the concentration of genomic DNA.
20. How should I measure the concentration of my DNA samples?
The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) when DNA concentrations range from 20 to 1000 ng/ul or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851) when DNA concentrations range from 0.1 to 100 ng/ul. Both of these kits use a fluorometric assay to measure double-stranded DNA within a sample.
21. Does the High Throughput Genomics Shared Resource provide researchers with access to a Qubit instrument?
The High Throughput Genomics Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856). These reagents can be purchased from Fisher Scientific.
22. Can I construct my own libraries for sequence analysis on an Illumina instrument?
Although the High Throughput Genomics Shared Resource offers support for all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing these libraries, quality control assays will be performed including a Qubit dsDNA HS Assay (library concentration), Agilent DNA ScreenTape Assay (size distribution), and qPCR using the KAPA Library Quantification Kit to normalize the molarity of libraries in preparation for sequencing.
23. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
Adapter dimer products, which typically appear as 120 to 140 bp bands on an Agilent DNA ScreenTape Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain a DNA insert. A library that is represented by 5% adapter dimer may be expected to yield as much as 60% adapter-only sequence reads. It is important for researchers that construct their own sequencing libraries to properly measure the quantity of DNA (or RNA) going into library prep and to use purification methods that select against the presence of adapter dimers when purifying the pcr-amplified library.
24. How long will my sequencing data be available for download on the GNomEx server?
Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Cancer Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to mark sequencing data for long-term storage in the cloud. Please contact the Cancer Bioinformatics Shared Resource for information on creating an account if you would like to participate in this long-term storage option. Alternatively, researchers can explore other options for data storage but they should be aware that the GNomEx server will only be able to support storage for a time period of approximately six months.
25. Does the HTG Shared Resource provide assistance with analysis of sequence data?
The HTG Shared Resource does not provide sequence analysis services. Please contact the Cancer Bioinformatics Shared Resource at the Huntsman Cancer Institute for assistance with analysis.
Contact Us
High-Throughput Genomics Director
Brian K. Dalley, PhD
High-Throughput Genomics Associate Director
Opal Allen, PhD
Governance
HCI Senior Director Oversight
Alana Welm, PhD
Faculty Advisory Committee Chair
Katherine Varley, PhD
Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD