The High Throughput Genomics Shared Resource provides multiple options for gene expression profiling services that enables library preparation from diverse quantities and qualities of starting material. These options include kits that support poly-A selection of mRNA, removal of rRNA, low input samples, and samples extracted from FFPE tissues. All libraries are constructed with unique dual indexes to allow multiplexing and sequence analysis on the Illumina platform. An overview of library preparation kits supported for RNA sequencing and answers to Frequently Asked Questions are provided below.
Overview of RNA Library Preparation
Illumina TruSeq Stranded mRNA Kit: Initiates library preparation using oligo-dT beads to capture RNA species containing a polyA tail. Following polyA RNA enrichment, the RNA is chemically fragmented and random primed for reverse transcription. The average insert size of libraries constructed with the TruSeq Stranded mRNA Library Prep Kit is 200 bp and approximately 90-95% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 100 to 1,000 ng of total RNA which should be delivered in a 12-30 µL volume. The kit works best with high quality RNA (RNA integrity number of 8 or higher) from any species in which mRNA contains a polyA tail.
Illumina TruSeq Stranded Total RNA Library Prep Kit: Initiates library preparation with the removal of rRNA using Ribo-Zero, a reagent consisting of biotinylated oligonucleotides that are complimentary to rRNA. The Ribo-Zero product line includes solutions to remove cytoplasmic and mitochondrial rRNA from total RNA samples purified from animal sources or cytoplasmic, mitochondrial, and chloroplast rRNA from plant samples. Following rRNA removal, the remaining RNA is chemically fragmented and random primed for reverse transcription. The average insert size of libraries constructed with the TruSeq Stranded Total RNA Library Prep Kit is 200 bp and approximately 70-90% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 100 to 1,000 ng of total RNA which should be delivered in a 10-15 µL volume. The kit is compatible with a wide range of sample quality including highly degraded RNA purified from formalin-fixed, paraffin embedded tissues. However, libraries constructed with this kit using RNA samples derived from formalin-fixed, paraffin embedded tissues routinely exhibit a high abundance of sequence reads that align to introns (40-60%). In all cases, it is essential that RNA samples are treated with DNase to minimize the contribution of sequence reads derived from residual genomic DNA in the sample. Failure to treat with DNase or inefficient DNase treatment can result in a significant fraction of intergenic reads in the sequence data.
Illumina TruSeq RNA Exome Kit: Enables the enrichment of coding regions within the transcriptome using a hybridization reaction with biotinylated oligonucleotides that are complimentary to the exome. The average insert size of libraries constructed with the TruSeq RNA Exome Kit is 150 bp and approximately 80-90% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 5 to 100 ng of total RNA which should be delivered in a 10-15 µL volume. The kit is compatible with a wide range of sample quality and significantly improves the percent of useful sequencing reads obtained from libraries derived from highly degraded RNA purified from formalin-fixed, paraffin embedded tissues. In all cases, it is essential that RNA samples are treated with DNase to minimize the contribution of sequence reads derived from residual genomic DNA in the sample.
New England BioLabs NEBNext Ultra II Directional RNA Library Prep: Enables removal of cytoplasmic and mitochondrial rRNA from a sample using a hybridization to oligonucleotides that are complimentary to rRNA that is followed by an RNase H digestion protocol. The rRNA Removal solution that is used with this kit was designed to target human, mouse, and rat rRNA, but it may be able to effectively remove rRNA from other animal species. Following rRNA removal, the RNA sample is chemically fragmented and random primed for reverse transcription. The average insert size of libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit is 200 bp and approximately 50-70% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 5 to 100 ng of total RNA which should be delivered in a 10-15 µL volume. This kit is compatible with a wide range of sample quality, however, in all cases it is essential that RNA samples are treated with DNase to minimize the contribution of sequence reads derived from residual genomic DNA in the sample.
Frequently Asked Questions
What quantity of RNA is required for library preparation?
Illumina TruSeq Stranded mRNA: A quantity of 100 to formalin-fixed, paraffin embedded ng of total RNA in a volume of 10-30 µL is recommended for constructing a library with the Illumina TruSeq Stranded mRNA Library Prep Kit.
Illumina TruSeq Stranded Total RNA: A quantity of 100 to 1,000 ng of total RNA in a volume of 10-15 µL is recommended for constructing a library with the Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero.
Illumina TruSeq RNA Exome: A quantity of 5 to 100 ng of total RNA in a volume of 10-15 µL is recommended for constructing a library with the Illumina Illumina TruSeq RNA Exome Kit.
New England BioLabs NEBNext Ultra II Directional RNA: A quantity of 5 to 100 ng of total RNA in a volume of 10-15 µL is recommended for constructing a library with the NEBNext Ultra II Directional RNA Library Prep.
What is the recommended concentration of RNA for library preparation?
Illumina TruSeq Stranded mRNA: RNA samples should be provided at a concentration of 5-200 ng/µL for samples that will be used for library construction with the Illumina TruSeq Stranded mRNA Library Prep Kit.
Illumina TruSeq Stranded Total RNA: RNA samples should be provided at a concentration of 10-200 ng/µL for samples that will be used for library construction with the Illumina TruSeq Stranded Total RNA Library Prep Kit.
Illumina TruSeq RNA Exome: RNA samples should be provided at a concentration of 1-50 ng/µL for samples that will be used for library construction with the Illumina TruSeq RNA Exome Kit.
New England BioLabs NEBNext Ultra II Directional RNA: RNA samples should be provided at a concentration of 1-10 ng/µL for samples that will be used for library construction with the NEBNext Ultra II Directional Library Prep Kit.
What quality of RNA (RNA integrity number [RIN]) is recommended for library preparation?
Illumina TruSeq Stranded mRNA: RNA samples with a RIN value between 8.0 and 10.0 are recommended for library preparation with the Illumina TruSeq Stranded mRNA Library Prep Kit. Samples with RIN values below 8.0 will exhibit increased levels of 3’ bias which can compromise the ability to compare gene expression profile data between different samples.
Illumina TruSeq Stranded Total RNA: RNA samples with a RIN value between 1.0 and 10.0 can be used for library preparation with the Illumina TruSeq Stranded Total RNA Library Prep Kit. This kit also works well with RNA samples that are purified from formalin-fixed, paraffin embedded tissues.
Illumina TruSeq RNA Exome: RNA samples with a RIN value between 1.0 and 10.0 can be used for library preparation with the Illumina TruSeq RNA Exome Kit. This kit also works well with RNA samples that are purified from formalin-fixed, paraffin embedded tissues.
New England BioLabs NEBNext Ultra II Directional RNA: RNA samples with a RIN value between 2.0 and 10.0 can be used for library preparation with the NEBNext Ultra II Directional Library Prep Kit.
Does the HTG Shared Resource perform sample quality assays prior to library construction?
All Kits: The HTG Shared Resource performs a Qubit assay to measure sample concentration and an Agilent ScreenTape Assay to measure the quality of RNA samples prior to library preparation. If a sample fails to meet quality specifications for the library preparation protocol that was chosen during the experiment order process, the researcher will be contacted prior to proceeding with library preparation.
What purification kits are recommended for extraction of RNA from tissue culture cells?
All Kits: Total RNA should be purified from tissue culture cells using a spin column such as those available in the Qiagen RNeasy Mini Kit (cat# 74104), Qiagen miRNeasy Mini Kit ((cat#2107004), or the Zymo Research Direct-zol RNA MiniPrep Kit (cat# R2050, R2051, R2060, R2061, or similar). In all cases, it is recommended to include on-column DNase treatment to minimize co-purification of DNA in the RNA sample. Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased separately (cat#79254).
What purification kits are recommended for extraction of RNA from tissues?
All Kits: Total RNA should be purified from tissue samples using a spin column such as those included with kits available through Qiagen or Zymo Research. Kits that initiate the purification process with the addition of QIAzol or Trizol significantly improve the purity of RNA from tissues that are high in fat, mucous, or yolk content. We recommend kits such as the Qiagen Lipid Tissue Mini Kit (cat# 74804), Qiagen miRNeasy Mini Kit (cat#2107004), or the Zymo Research Direct-zol RNA MiniPrep Kit (cat# R2050, R2051, R2060, R2061, or similar). In all cases, it is recommended to include DNase treatment to minimize the co-purification of DNA. Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased separately (cat#79254).
What purification kits are recommended for extraction of RNA from formalin-fixed, paraffin embedded tissues?
All Kits: Total RNA can be purified from formalin-fixed, paraffin embedded tissues using the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234), the Ambion RecoverAll Total Nucleic Acids Kit (cat#AM1975), or the Zymo Research Quick-RNA FFPE Kit (cat#1008). In all cases, it is recommended to include DNase treatment to minimize co-purification of DNA in the RNA sample. The Ambion and Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased separately (cat#79254).
Should RNA be treated with DNase during the purification process?
All Kits: It is important to treat all RNA samples with DNase as residual DNA in the sample can result in a substantial volume of genomic DNA-derived reads in RNA sequencing data. Both the Qiagen RNeasy kits and the Zymo Research RNA Purification kits allow for the optional inclusion of applying DNase (Qiagen cat#79254 and Zymo cat# E1010) to the spin column while purifying a RNA sample.
Do you recommend using a Qiagen kit that includes a gDNA eliminator column when purifying RNA samples?
All Kits: We advise against reliance on a gDNA Eliminator Column to remove residual DNA during the RNA purification process. In our experience, the gDNA Eliminator Column is a less effective solution for removal of residual DNA when compared to treating the sample with DNase on the spin column. The use of these columns can result in excess of 60-80% intergenic reads in RNA sequencing data. In conversations with Qiagen, their technical support team recommended that one can always include on-column DNase treatment during the RNA purification process when preparing samples for more sensitive experiments such as next generation sequencing.
Does the HTG Shared Resource provide access to a Qiagen TissueLyzer?
All Kits: A Qiagen TissueLyzer LT is available at the HTG Shared Resource for extraction of RNA from tissue samples. The TissueLyzer LT is able to simultaneously disrupt up to 12 tissues by vigorously shaking the samples in the presence of RNA purification buffer containing a stainless-steel bead. A carrying bag is available to transport the instrument to your lab.
What buffer should be used to elute RNA from a spin column?
All Kits: RNA should be eluted from spin columns or diluted to a lower concentration using RNase-free water.
Should I add carrier RNA/DNA when purifying low input samples?
All Kits: We recommend avoiding the addition of carrier RNA/DNA when purifying nucleic acid samples. Carrier products added to a sample can function as template during the library preparation process and substantially contribute to the sequence reads. These products also interfere with accurate assessment of the concentration and quality of the target RNA sample.
How should I store purified RNA samples?
All Kits: RNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C), both of which minimize the non-specific binding of dilute RNA solutions to the surface of the plastic tube.
Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for RNA extraction?
All Kits: The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone method for RNA purification is strongly discouraged. The quality of RNA purified by these protocols tends to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process.
Does the HTG Shared Resource provide RNA purification services?
All Kits: The HTG Shared Resource does not provide RNA purification services. RNA Purification services can be obtained from the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu) or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). In all cases you should request that RNA purification includes DNase treatment of the sample.
Is the NanoDrop a good choice for measuring the concentration of an RNA sample?
All Kits: An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid including DNA, RNA, small nucleic acid fragments, or nucleotides. The NanoDrop may provide useful information when screening the concentration of RNA samples that are above 10 ng/µL if the A260/230 ratio is between the range of 1.6 to 2.4. However, the use of fluorescent dyes such as those available for use with the Qubit, provide a more accurate solution for measuring the concentration of an RNA sample.
How should I measure the concentration of my RNA samples?
All Kits: The concentration of RNA samples should be measured using either the Qubit RNA Broad Range Assay Kit (Fisher cat#Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat#Q32852).
Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
All Kits: The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Required reagents for measuring RNA concentration include either the Qubit RNA Broad Range Assay Kit (Fisher cat#Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat#Q32852) in addition to Qubit Assay Tubes (Fisher cat#Q32856).
How can I determine if Ribo-Zero is compatible with the species that I work with?
Illumina TruSeq Stranded Total RNA: The HTG Shared Resource supports the following Ribo-Zero products. Species compatibility information relevant to the Ribo-Zero products can be reviewed on Illumina’s website.
- Ribo-Zero Gold: removes cytoplasmic and mitochondrial rRNA from human, mouse, rat, and other animal-derived RNA samples.
- Ribo-Zero plant: removes cytoplasmic, mitochondrial, and chloroplast rRNA from plant RNA samples.
- Ribo-Zero Globin: removes cytoplasmic and mitochondrial rRNA in addition to globin mRNA from human, mouse, rat, and other animal-derived RNA samples.
How many reads are recommended for each RNA-seq library?
Illumina TruSeq Stranded mRNA, Illumina TruSeq RNA Exome: It is recommended to have a minimum of 20-30 million read-pairs for libraries constructed with the TruSeq Stranded mRNA or the TruSeq RNA Exome Kit.
Illumina TruSeq Stranded Total RNA, New England BioLabs NEBNext Ultra II Directional RNA: It is recommended to have a minimum of 25-50 million read-pairs for RNA libraries derived from human or mouse samples that were constructed using a rRNA depletion reagent such as Illumina Ribo-Zero or NEB rRNA Removal Solution.
What percentage of sequence reads from an RNA-seq library will align to exons?
Illumina TruSeq Stranded mRNA: Sequence reads derived from libraries constructed with the Illumina TruSeq Stranded mRNA Library Prep Kit typically exhibit 90-95% alignment to exons (coding plus UTR), 2-6% to introns and 1-3% to intergenic sequences.
Illumina TruSeq Stranded Total RNA: Sequence reads derived from libraries constructed with the Illumina TruSeq Stranded Total RNA Library Prep kit with Ribo-Zero typically exhibit 60-80% alignment to exons (coding plus UTR), 5-20% to introns, and 2-10% to intergenic sequences. Samples purified from formalin-fixed, paraffin embedded tissues typically exhibit a higher percentage (20-40%) of reads that align to introns. A failure to efficiently treat an RNA sample with DNase may result in a much higher percentage of reads that align to intergenic sequences.
Illumina TruSeq RNA Exome: Sequence reads derived from libraries constructed with the Illumina TruSeq RNA Exome Kit typically exhibit 85-90% alignment to exons (coding plus UTR), 5-10% to introns, and 1-5% to intergenic sequences.
New England BioLabs NEBNext Ultra II Directional RNA: Sequence reads derived from libraries constructed with the NEBNext Ultra II Directional Library Prep Kit typically exhibit 50-60% alignment to exons (coding plus UTR), 20-30% to introns, and 5-10% to intergenic sequences. A failure to efficiently treat an RNA sample with DNase may result in a much higher percentage of reads that align to intergenic sequences.
Can I construct my own libraries for sequence analysis on an Illumina sequencer?
All Kits: Although the HTG Shared Resource is setup to support all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing, these libraries will experience multiple quality control assays which include a Qubit dsDNA HS Assay, Agilent ScreenTape Assay, and Kapa BioSystems qPCR. Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.
Should I be concerned if adapter dimer products are present in the RNA-seq library that I constructed?
All Kits: Adapter dimer products, which appear as 120 to 140 bp bands on a DNA TapeStation Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain cDNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data delivered from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads from a NovaSeq flow cell.
How does the HTG Shared Resource qualify libraries prior to sequencing?
All Kits: Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq, HiSeq 2500, and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.
What sequences are used for adapter trimming of RNA-seq libraries?
All Kits: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from RNA-seq library prep kits supported by the HTG Shared Resource:
Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Do RNA-seq libraries include both mRNA and miRNA species?
All Kits: The construction of mRNA-centric sequencing libraries includes a step in which random primers are used to initiate reverse transcription. Random priming does not work in retaining full sequence information for miRNA molecules. In contrast, miRNA libraries are constructed through the direct ligation of adapters to the ends of small RNA molecules using RNA ligases. These ligases work well with small molecules but their efficiency is significantly diminished with RNA molecules exceeding 100 nucleotides.
Do RNA library prep kits work with prokaryote samples?
Illumina TruSeq Stranded Total RNA: Illumina discontinued the Ribo-Zero Bacteria stand-alone product on November 2, 2018. The HTG Shared Resource previously substituted this product into the TruSeq Stranded Total RNA Library Prep Kit to enable support for rRNA-depleted libraries from bacterial RNA samples. Although we do still have some Ribo-Zero Bacteria reagent, this is only a short-term solution and we will be reviewing alternative kits for supporting RNA-seq library preparation with bacterial samples.
How long will sequencing data from by genomic DNA libraries be available for download on the GNomEx server?
All Kits: Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Seven Bridges for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Seven Bridges to enable transfer of data. Otherwise, researchers can explore other options for data storage but they should be aware that the GNomEx server is unable to support a solution in excess of 6 months.
Does the HTG Shared Resource provide assistance with analysis of sequence data?
All Kits: The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.
Contact Us
High-Throughput Genomics Director
Brian K. Dalley, PhD
High-Throughput Genomics Associate Director
Opal Allen, PhD
Governance
HCI Senior Director Oversight
Alana Welm, PhD
Faculty Advisory Committee Chair
Katherine Varley, PhD
Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD