The High Throughput Genomics Shared Resource provides multiple options for gene expression profiling services that enables library preparation from diverse quantities and qualities of starting material. These options include kits that support poly-A selection of mRNA, depletion of rRNA, RNA Exome enrichment or 3’ Tag RNA-seq strategies. An overview of library preparation kits supported for RNA sequencing and answers to Frequently Asked Questions are provided below.
Overview of RNA Library Preparation
Lexogen QuantSeq 3-mRNA-Seq V2 Library Prep Kit
The Lexogen QuantSeq 3’ mRNA-Seq kit produces a strand specific library that represents the 3’ end of poly(A) RNA. Library preparation is initiated by oligo-dT priming of the poly(A) tail of mRNA which yields a single library fragment from each transcript. This feature of the Quant Seq library enables accurate directional, gene counting of mRNA transcripts. The average insert size of Lexogen QuantSeq libraries is approximately 200 bp (ranging from 100-600 bp) and approximately 80-85% of the sequence reads align to exons in the 3’ end of the RNA transcript. The recommended input for library construction ranges from 10 to 500 ng of total RNA which should be delivered in a 12-15 µl volume. Quantitation of the samples on a Qubit fluorometer is included as part of the library preparation package. The kit works with both high quality RNA in addition to partially degraded RNA. The recommended read depth for this library is 5-10 million reads per sample.
NEBNext Ultra II RNA Library Prep Kit w/ polyA mRNA isolation (non-directional)
The New England BioLabs NEBNext Ultra II RNA Library Prep kit combined with the Poly(A) mRNA Magnetic Isolation Module initiates library preparation through the use of oligo-dT beads to enrich for RNA species containing a poly-A tail. Following this enrichment step, the RNA is chemically fragmented and random primed for reverse transcription to initiate construction of a full transcript, non-directional RNA sequencing library. The average insert size of libraries constructed with the Ultra II Directional RNA Library Prep kit is 200 bp and approximately 85% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 10 to 500 ng of total RNA which should be delivered in a 12-30 µl volume. The kit works best with high quality RNA (RIN value of 8 or higher) which is evaluated on an Agilent RNA ScreenTape assay and included as part of the library preparation package. The recommended read depth for this library is 15-20 million reads per sample.
NEBNext Ultra II Directional RNA Library Prep Kit w/ polyA mRNA isolation
The New England BioLabs NEBNext Ultra II Directional RNA Library Prep kit combined with the Poly(A) mRNA Magnetic Isolation Module initiates library preparation through the use of oligo-dT beads to enrich for RNA species containing a poly-A tail. Following this enrichment step, the RNA is chemically fragmented and random primed for reverse transcription to enable construction of a full transcript, strand-specific RNA sequencing library. The average insert size of libraries constructed with the Ultra II Directional RNA Library Prep kit is 200 bp and approximately 90-95% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 10 to 1000 ng of total RNA which should be delivered in a 12-30 µl volume. The kit works best with high quality RNA (RIN value of 8 or higher) which is evaluated on an Agilent RNA ScreenTape assay and included as part of the library preparation package. The recommended read depth for this library is 15-30 million reads per sample.
NEBNext Ultra II Directional RNA Library Prep Kit w/ rRNA Depletion
The New England BioLabs NEBNext Ultra II Directional RNA Library Prep enables the removal of cytoplasmic and mitochondrial rRNA from a sample by hybridization to complimentary oligonucleotides followed by RNase H degradation of the hybridized RNA molecules. NEB offers rRNA depletion modules for human/mouse/rat, human/mouse/rat plus globin mRNA and also for bacteria. Each depletion module is specific for the referenced organisms as these kits do not perform well in cross-species hybridizations. Following rRNA depletion, the RNA sample is chemically fragmented and random primed for reverse transcription to initiate the construction of a full transcript, strand-specific RNA sequencing library. The average insert size of libraries constructed with the NEBNext Ultra II Directional RNA Library Prep kit is 200 bp and approximately 50-70% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 5 to 1000 ng of total RNA which should be delivered in a 10-15 µl volume. Although the kit is compatible with both high-quality RNA samples in addition to RNA samples that are highly degraded, the library preparation package does include evaluation of all samples on an Agilent RNA ScreenTape assay. In all cases, RNA samples should be treated with DNase as part of the RNA purification process to minimize the contribution of sequence reads derived from residual genomic DNA in the sample. A failure to treat with DNase or inefficient DNase treatment can result in a significant fraction of sequence reads derived from genomic DNA.
RNA Exome with NEB Directional RNA and SureSelect Human All Exon v8 enrichment
RNA Exome is frequently used for library preparation of highly degraded RNA samples purified from FFPE tissue sections. Directional libraries are constructed from total RNA using the NEBNext Ultra II Directional RNA Library Prep kit. Following pcr amplification, libraries are combined as four-plex pools that are hybridized with the Agilent SureSelect Human All Exon v8 panel to enrich for exon coding regions of the total RNA library. The average insert size of FFPE RNA libraries constructed with the RNA Exome library prep is 150 bp and approximately 80% of the sequence reads derived from these libraries align to exons. The recommended input for library construction ranges from 10 to 100 ng of total RNA which should be delivered in a 10-15 µl volume. Prior to initiating library preparation, the RNA samples are evaluated on an Agilent RNA ScreenTape assay which is included as part of the library preparation package. In all cases, RNA samples should be treated with DNase as part of the RNA purification process to minimize the contribution of sequence reads derived from residual genomic DNA in the sample. A failure to treat with DNase or inefficient DNase treatment can result in a significant fraction of sequence reads derived from genomic DNA.
TruSeq Stranded Total RNA Prep with Ribo-Zero Gold
The Illumina TruSeq Stranded Total RNA Library Prep Gold kit initiates library preparation with the depletion of rRNA using Ribo-Zero Gold, a reagent consisting of biotinylated oligonucleotides that are complimentary to human/mouse/rat cellular and mitochondrial rRNA. An alternative version, Ribo-Zero Globin is available that also enables depletion of globin mRNA from the total RNA sample. Although RiboZero Gold reagent was designed for human/mouse/rat, this rRNA depletion reagent also works well with most other animal species. Following rRNA depletion, the RNA sample is chemically fragmented and random primed for reverse transcription to initiate the construction of a strand-specific RNA sequencing library. The average insert size of libraries prepared with the Illumina Stranded Total RNA Library Prep with Ribo-Zero Plus is 200 bp and approximately 50-70% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 100 to 1000 ng of total RNA which should be delivered in a 10-20 µl volume. Although the kit is compatible with both high-quality RNA samples in addition to RNA samples that are highly degraded, the library preparation package does include evaluation of all samples on an Agilent RNA ScreenTape assay. In all cases, RNA samples should be treated with DNase during the RNA purification process. A failure to treat with DNase or inefficient DNase treatment can result in a significant fraction of sequence reads derived from genomic DNA. Considering that the TruSeq Stranded Total RNA kit is a legacy kit, we do not encourage its use for new projects with human, mouse or rat samples.
TruSeq Stranded Total RNA Library Prep Plant
The Illumina TruSeq Stranded Total RNA Library Prep Plant kit initiates library preparation with the removal of rRNA using Ribo-Zero Plant, a reagent consisting of biotinylated oligonucleotides that are complimentary to plant cellular, mitochondrial and chloroplast rRNA. Following rRNA removal, the remaining RNA is chemically fragmented and random primed for reverse transcription to initiate the construction of a strand-specific RNA sequencing library. The average insert size of libraries constructed with the TruSeq Stranded Total RNA Library Prep kit is 200 bp and approximately 50-70% of the sequence reads derived from these libraries align to RNA exons. The recommended input for library construction ranges from 100 to 1000 ng of total RNA which should be delivered in a 10-20 µl volume. Although the kit is compatible with both high-quality RNA samples in addition to RNA samples that are highly degraded, the library preparation package does include evaluation of all samples on an Agilent RNA ScreenTape assay. In all cases, RNA samples should be treated with DNase during RNA purification. A failure to treat with DNase or inefficient DNase treatment can result in a significant fraction of sequence reads derived from genomic DNA.
Frequently Asked Questions
- Please provide a price estimate for the following RNA-seq projects.
- How many sequence reads are recommended for each RNA-seq library?
- What sequences are used for adapter trimming of RNA-seq libraries?
- What quantity of RNA is required for library preparation?
- What quality of RNA integrity number (RIN) is recommended for library preparation?
- How can I determine if the NEBNext rRNA Depletion Kit is compatible with the species that I work with?
- How can I determine if TruSeq Ribo-Zero is compatible with the species that I work with?
- What percentage of sequence reads from an RNA-seq library will align to exons?
- Are both mRNA and miRNA represented in RNA-seq libraries?
- What information does the DV200 value provide?
- Does the HTG Shared Resource perform sample quality assays prior to library construction?
- What purification kits are recommended for extraction of RNA from tissue culture cells?
- What purification kits are recommended for extraction of RNA from fresh tissues or from cell populations purified by FACS?
- What purification kits are recommended for extraction of RNA from formalin-fixed, paraffin embedded tissues?
- Should RNA be treated with DNase during the purification process?
- Do you recommend using Trizol or phenol/chloroform as a stand-alone reagent for RNA extraction?
- Should I add carrier RNA/DNA when purifying low input samples?
- Does the HTG Shared Resource provide access to a Qiagen TissueLyzer?
- Does the HTG Shared Resource provide RNA purification services?
- Does the NanoDrop provide an accurate measurement for the concentration of an RNA sample?
- How does the HTG Shared Resource measure the concentration of RNA samples?
- Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
- Can I construct my own libraries for sequence analysis on an Illumina instrument?
- Should I be concerned if adapter dimer products are present in the RNA-seq library that I constructed?
- How does the HTG Shared Resource qualify libraries prior to sequencing?
- How long will my sequencing data be available for download on the GNomEx server?
- Does the HTG Shared Resource provide assistance with analysis of sequence data?
1. Please provide a price estimate for the following RNA-seq projects:
Example 1: 3’-mRNA Sequencing of 10 Total RNA Samples.
- Library Prep with Lexogen QuantSeq 3’mRNA-Seq Library Prep Kit (includes sample QC by Qubit assay, library preparation and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 10 million read-pairs per sample.
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| Lexogen QuantSeq 3’ mRNA-Seq V2 Library Prep Kit | 10 | $50 | $500 |
| NovaSeq X Reagent Kit _150x150 bp Sequencing (100 M read-pairs) | 1 | $150 | $150 |
| Total | $650 | ||
Example 2: Directional mRNA Sequencing of 10 Total RNA Samples.
- Library Prep with NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation (includes sample QC by Qubit assay plus Agilent RNA ScreenTape assay, library preparation and library QC/pooling)
- NovaSeq X 150x150 bp sequencing with 20 million read-pairs per sample.
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| NEBNext Ultra II Directional RNA Library Prep with poly(A) mRNA Isolation | 10 | $90 | $900 |
| NovaSeq X Reagent Kit _150x150 bp Sequencing (100 M read-pairs) | 2 | $150 | $300 |
| Total | $1200 | ||
Example 3: Directional RNA-seq that includes rRNA depletion of 40 Total RNA Samples isolated from human tissues.
- Library Prep with NEBNext Ultra II Directional RNA Library Prep with rRNA Depletion Kit H/M/R (includes sample QC by Qubit assay plus Agilent RNA ScreenTape assay, library prep and library QC/pooling).
- NovaSeq 150x150 bp sequencing with 25 million read-pairs per sample (total of 1000 million read-pairs).
| Description | Quantity | Unit Price | Extended Price |
|---|---|---|---|
| NEBNext Ultra II Directional RNA Library Prep with rRNA Depletion Kit | 40 | $120 | $4,800 |
| NovaSeq X 10B Reagent Kit_150x150 bp Sequencing (1250 M reads/lane) | 1 | $1,250 | $1,250 |
| Total | $6,050 | ||
2. How many sequence reads are recommended for each RNA-seq library?
Lexogen QuantSeq 3’mRNA-Seq Library Prep: It is recommended to target 5-10 million reads per sample for libraries constructed with the Lexogen QuantSeq kit.
NEBNext Ultra II RNA Library Prep with poly(A) mRNA Isolation (non—directional): It is recommended to have a minimum of 15-20 million read-pairs for libraries constructed with the NEBNext Ultra II RNA Library Prep Kit with poly(A) Isolation (non-directional).
NEBNext Ultra II Directional RNA Library Prep with poly(A) mRNA Isolation: It is recommended to have a minimum of 15-30 million read-pairs for libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation.
NEBNext Ultra II Directional RNA Library Prep w/ rRNA Depletion: It is recommended to have a minimum of 25-50 million read-pairs for libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit with the use of rRNA depletion products (Human/mouse/rat, or Bacteria).
RNA Exome with NEB Directional RNA and SureSelect Human All Exon v8 enrichment: It is recommended to target 25-50 million read-pairs for RNA Exome libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit with Agilent SureSelect Human All Exon v8 enrichment.
TruSeq Stranded Total RNA Library Prep Gold/Globin/Plant: It is recommended to have a minimum of 25-50 million read-pairs for libraries constructed with the TruSeq Stranded Total RNA with Ribo-Zero Gold, Globin or Plant depletion modules.
3. What sequences are used for adapter trimming of RNA-seq libraries?
Lexogen QuantSeq 3’ mRNA-Seq Library Prep: The following sequences can be used for trimming adapters from the 3’ end of Read 1 of libraries constructed with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep. Note that the paired-end read is not used for analysis of QuantSeq libraries.
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
NEBNext RNA Libraries and Illumina TruSeq RNA Libraries: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from RNA-seq library prep kits that are referenced above:
- Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
- Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
4. What quantity of RNA is required for library preparation?
Lexogen QuantSeq 3’mRNA-Seq Library Prep: A quantity of 10 to 500 ng of total RNA should be delivered in a volume of 12-15 µl
NEBNext Ultra II RNA Library Prep Kit with poly(A) mRNA Isolation (non-directional): A quantity of 10 to 500 ng of total RNA should be delivered in a volume of 15-30 µl.
NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation: A quantity of 10 to 1000 ng of total RNA should be delivered in a volume of 15-30 µl.
NEBNext Ultra II Directional RNA Library Prep Kit with rRNA Depletion Kit: A quantity of 2 to 1000 ng of total RNA should be delivered in a volume of 12-15 µl.
RNA Exome with NEB Directional RNA and SureSelect Human All Exon v8 enrichment: A quantity of 10 to 100 ng of total RNA should be delivered in a volume of 12-15 µl.
TruSeq Stranded Total RNA Library Prep Gold/Plant: A quantity of 100 to 1,000 ng of total RNA should be delivered in a volume of 10-15 µl.
5. What quality of RNA integrity number (RIN) is recommended for library preparation?
Lexogen QuantSeq 3’mRNA-Seq Library Prep: The Lexogen QuantSeq kit captures the 3’ end of RNA transcripts and therefore it works well with both high quality RNA samples in addition to partially degraded samples. For that reason, we do not evaluate the RIN value of samples when libraries are constructed with the Lexogen kit.
NEBNext Ultra II RNA Library Prep Kit with poly(A) mRNA Isolation (non-directional): RNA samples with a RIN value between 8 and 10 are recommended for library preparation with the NEBNext Ultra II RNA Library Prep Kit with poly(A) mRNA Isolation. Samples with RIN values below 8 will exhibit increased levels of 3’ bias which can compromise the ability to compare gene expression profile data across samples
NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation: RNA samples with a RIN value between 8 and 10 are recommended for library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation. Samples with RIN values below 8 will exhibit increased levels of 3’ bias which can compromise the ability to compare gene expression profile data across samples.
NEBNext Ultra II Directional RNA Library Prep w/ rRNA Depletion: Human, mouse, rat or bacteria RNA samples with a RIN value between 1.0 and 10.0 can be used for library preparation with the NEBNext Ultra II Directional Library Prep Kit with rRNA Depletion.
RNA Exome with NEB Directional RNA and SureSelect Human All Exon v8 enrichment: The RNA Exome protocol was developed for FFPE RNA samples which are typically highly degraded. The protocol works best with RNA samples that have a dv200 score of 20% or greater.
TruSeq Stranded Total RNA Library Prep with the Gold/Globin/Plant depletion modules: RNA samples from diverse animal and plant species with a RIN value between 1 and 10 can be used for library preparation with the Illumina TruSeq Stranded Total RNA Library Prep kit.
6. How can I determine if the NEBNext rRNA Depletion Kit is compatible with the species that I work with?
New England BioLabs offers three unique rRNA Depletion kits for use with library preparation. Specifications for these kits are listed below:
NEBNext rRNA Depletion Kit (Human, Mouse, Rat): This kit substantially removes cytoplasmic rRNA and mitochondrial rRNA from human, mouse or rat total RNA samples. However, this kit does not work effectively in removing rRNA from total RNA samples derived from other species.- NEBNext Globin and rRNA Depletion Kit (Human, Mouse, Rat): This kit substantially removes globin mRNA, cytoplasmic rRNA and mitochondrial rRNA from human, mouse or rat total RNA samples. However, this kit does not work effectively in removing rRNA from total RNA samples derived from other species.
- NEBNext rRNA Depletion Kit (bacteria): This kit substantially removes 5S, 16S and 23S rRNA from total RNA samples derived from either gram-positive or gram-negative organisms.
7. How can I determine if TruSeq Ribo-Zero is compatible with the species that I work with?
Illumina offers three unique rRNA Depletion kits for use with its TruSeq line of RNA library preparation kits. Specifications for these kits are listed below: Species compatibility information relevant to the Ribo-Zero products can be reviewed on Illumina’s website.
TruSeq Ribo-Zero Gold: This kit substantially removes cytoplasmic rRNA and mitochondrial rRNA from human, mouse or rat total RNA samples. It is also compatible with many other species documented on the Illumina Ribo-Zero Species Compatibility webpage. This kit works effectively with RNA samples from human, mouse, rat and several other model organisms. However, it does not work well with Drosophila RNA samples.- TruSeq Ribo-Zero Globin: This kit substantially removes globin mRNA, cytoplasmic rRNA and mitochondrial rRNA from human, mouse or rat total RNA samples. It is also compatible with many other species documented on the Illumina Ribo-Zero Species Compatibility webpage.
- TruSeq Ribo-Zero Plant: This kit substantially removes cytoplasmic, mitochondrial and chloroplast rRNA from total RNA samples derived from diverse plant species. Please refer to Illumina Ribo-Zero Species Compatibility webpage for documentation on trials with different species.
8. What percentage of sequence reads from an RNA-seq library will align to exons?
Lexogen QuantSeq 3’mRNA-Seq Library Prep: Sequence reads derived from libraries constructed with the Lexogen QuantSeq 3’mRNA-Seq kit typically exhibit approximately 75% alignment to exons (3’ UTR plus 3’ coding exon), 9-10% to introns and 4-5% to intergenic sequences.
NEBNext Ultra II RNA Library Prep Kit with poly(A) mRNA Isolation (non-directional): Sequence reads derived from libraries constructed with the NEBNext Ultra II RNA Library Prep Kit with polyA mRNA Isolation typically exhibit 90-95% alignment to exons (coding plus UTR), 2-6% to introns and 1-3% to intergenic sequences.
NEBNext Ultra II Directional RNA Library Prep Kit with poly(A) mRNA Isolation: Sequence reads derived from libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit with polyA mRNA Isolation typically exhibit 90-95% alignment to exons (coding plus UTR), 3-4% to introns and 1-2% rRNA.
NEBNext Ultra II Directional RNA Library Prep Kit w/ rRNA Depletion: Sequence reads derived from libraries constructed with the NEBNext Ultra II Directional RNA Library Prep Kit typically exhibit 50-70% alignment to exons (coding plus UTR), 10-30% to introns, and 2-10% to intergenic sequences. A failure to efficiently treat an RNA sample with DNase may result in a much higher percentage of reads that align to intergenic sequences.
RNA Exome with NEB Directional RNA and SureSelect Human All Exon v8 enrichment: Approximately 80% of the reads from RNA Exome libraries are uniquely assigned to the transcriptome. These reads are represented by 80-85% alignment to exons (coding plus UTR), 2-6% to introns and 1-3% to intergenic sequences
TruSeq Stranded Total RNA Prep with Ribo-Zero Gold/Globin/Plant: Sequence reads derived from libraries constructed with the TruSeq Stranded Total RNA Library Prep kits that include treatment with a Ribo-Zero product typically exhibit 50-70% alignment to exons (coding plus UTR), 10-30% to introns, and 2-10% to intergenic sequences.
9. Are both mRNA and miRNA represented in RNA-seq libraries?
The construction of mRNA-centric sequencing libraries includes a step in which random primers are used to initiate reverse transcription. Random priming does not work in retaining full sequence information for miRNA molecules. In contrast, miRNA libraries are constructed through the direct ligation of adapters to the ends of small RNA molecules using RNA ligases. These ligases work well with small molecules but their efficiency is significantly diminished with RNA molecules exceeding 100 nucleotides.
10. What information does the DV200 value provide?
The RIN value of samples purified from FFPE tissues is typically very low and therefore a DV200 measurement often provides more informative information on the quality of these samples. DV200 represents the percentage of RNA fragments that are greater or equal to 200 nucleotides in size. This measurement is particularly important for FFPE samples which tend to be highly degraded. Samples should have a DV200 value of at least 25% to perform well in library preparation.
11. Does the HTG Shared Resource perform sample quality assays prior to library construction?
The High Throughput Genomics Shared Resource performs a Qubit assay to measure sample concentration and an Agilent RNA ScreenTape assay to evaluate the quality of RNA samples prior to RNA library preparation when using either NEB or Illumina TruSeq kits. If a sample fails to meet quality specifications for the library preparation protocol that was chosen during the experiment order process, the researcher will be contacted prior to proceeding with library preparation.
12. What purification kits are recommended for extraction of RNA from tissue culture cells?
Total RNA should be purified from tissue culture cells using a spin column such as those available in the Qiagen RNeasy Mini Kit (cat# 74104), Qiagen miRNeasy Mini Kit ((cat#2107004) or the Zymo Research Direct-zol RNA MiniPrep Kit (cat# R2050, R2051, R2060, R2061 or similar). In all cases, it is recommended to include on-column DNase treatment to minimize co-purification of DNA in the RNA sample. Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased separately (cat#79254).
13. What purification kits are recommended for extraction of RNA from fresh tissues or from cell populations purified by FACS?
Total RNA should be purified from tissue samples or FACS-sorted cells using a spin column such as those included in kits available through Qiagen or Zymo Research. Kits that include either QIAzol or Trizol significantly improve the purity of RNA from tissues that are high in fat, mucous or yolk content and are also effective in removing BSA from the FACS-sorting process. We recommend kits such as the Qiagen Lipid Tissue Mini Kit (cat# 74804), Qiagen miRNeasy Mini Kit (cat#2107004) or the Zymo Research Direct-zol RNA MiniPrep Kit (cat# R2050, R2051, R2060, R2061 or similar). In all cases, it is recommended to include DNase treatment to minimize the co-purification of DNA. Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased separately (cat#79254).
14. What purification kits are recommended for extraction of RNA from formalin-fixed, paraffin embedded tissues?
Total RNA can be purified from FFPE tissues using the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234), the Ambion RecoverAll Total Nucleic Acids Kit (cat#AM1975) or the Zymo Research Quick-RNA FFPE Kit (cat#1008). In all cases, it is recommended to include DNase treatment to minimize co-purification of DNA in the RNA sample. The Ambion and Zymo Research kits include DNase whereas Qiagen kits require DNase to be purchased as a separate stand-alone product (cat#79254).
15. Should RNA be treated with DNase during the purification process?
All RNA samples to be used for next generation sequencing should be treated with DNase during the RNA purification process. A failure to follow this recommendation may result in residual DNA in the sample that results in an elevated quantity of genomic DNA-derived reads in RNA sequencing data. Both the Qiagen RNeasy kits and the Zymo Research RNA Purification kits allow for the optional inclusion of applying DNase (Qiagen cat#79254 and Zymo cat# E1010) to the spin column while purifying an RNA sample.
16. Do you recommend using Trizol or phenol/chloroform as a stand-alone reagent for RNA extraction?
The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone product for RNA purification is strongly discouraged. The quality of RNA purified with these reagents tend to be lower due to organic carry-over and the co-precipitation of biomolecules which may be inhibitory to downstream enzymatic steps in the library preparation process.
17. Should I add carrier RNA/DNA when purifying low input samples?
We recommend avoiding the addition of carrier RNA/DNA products when purifying nucleic acid samples. Carrier products added to a sample can function as template during the library preparation process and therefore will contribute to the sequence reads. These products also interfere with accurate assessment of the concentration and quality of the purified RNA sample.
18. Does the HTG Shared Resource provide access to a Qiagen TissueLyzer?
A Qiagen TissueLyzer LT is available at the HTG Shared Resource for extraction of RNA from tissue samples. The TissueLyzer LT is able to simultaneously disrupt up to 12 tissues at a time by vigorously shaking the samples in the presence of RNA purification buffer containing a stainless-steel bead. The use of this instrument is available at no cost and a carrying bag is available to transport the instrument to your lab.
19. Does the HTG Shared Resource provide RNA purification services?
RNA purification services can be obtained from either the Biorepository and Molecular Pathology Shared Resource located in Huntsman Cancer Institute or the Cellular Translational Research Core Facility located in the Wintrobe Building.
20. Does the NanoDrop provide an accurate measurement for the concentration of an RNA sample?
An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid including DNA, RNA, small nucleic acid fragments, or nucleotides. The NanoDrop may provide useful information when measuring the concentration of RNA samples that are above 10 ng/µl as these samples usually tend to consist of greater than 90% RNA. Samples with lower concentrations tend to result in a less accurate measurement. The use of fluorescent dyes such as those available for use with the Qubit, is our preferred method for measuring RNA concentration.
21. How does the HTG Shared Resource measure the concentration of RNA samples?
The concentration of RNA samples is measured using either the Qubit RNA Broad Range Assay Kit (Fisher cat# Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat# Q32852).
22. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
The High Throughput Genomics Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Required reagents for measuring RNA concentration include either the Qubit RNA Broad Range Assay Kit (Fisher cat# Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat# Q32852) in addition to Qubit Assay Tubes (Fisher cat# Q32856).
23. Can I construct my own libraries for sequence analysis on an Illumina instrument?
The HTG Shared Resource welcomes libraries constructed by individual research labs. Prior to sequencing these libraries, quality control assays will be performed including a Qubit dsDNA HS Assay (library concentration), Agilent DNA ScreenTape Assay (size distribution), and qPCR using a KAPA Library Quantification Kit to normalize the molarity of libraries in preparation for sequencing.
24. Should I be concerned if adapter dimer products are present in the RNA-seq library that I constructed?
Adapter dimer products, which appear as 120 to 140 bp bands on a DNA ScreenTape assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data derived from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in up to 65% of the sequence reads on a NovaSeq 6000 flow cell being contributed by adapter dimers. Adapter dimer sequences can be avoided by performing a double purification at the end of library preparation.
25. How does the HTG Shared Resource qualify libraries prior to sequencing?
Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent DNA ScreenTape assay (size distribution), and qPCR with the KAPA Library Quantification Kit for Illumina Platforms (normalize libraries in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.
26. How long will my sequencing data be available for download on the GNomEx server?
Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Cancer Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to mark sequencing data for long-term storage in the cloud. Please contact the Cancer Bioinformatics Shared Resource for information on creating an account if you would like to participate in this long-term storage option. Alternatively, researchers can explore other options for data storage but they should be aware that the GNomEx server will only be able to support storage for a time period of approximately six months.
27. Does the HTG Shared Resource provide assistance with analysis of sequence data?
The HTG Shared Resource does not provide sequence analysis services. Please contact the Cancer Bioinformatics Shared Resource at Huntsman Cancer Institute for assistance with analysis.
Contact Us
High-Throughput Genomics Director
Brian K. Dalley, PhD
High-Throughput Genomics Associate Director
Opal Allen, PhD
Governance
Huntsman Cancer Institute Senior Director Oversight
Aik Choon Tan, PhD
Faculty Advisory Committee Chair
Jason Gertz, PhD
Faculty Advisory Committee Members
Kaitlin Basham, PhD
Allison Carey, MD, PhD
Vaia Florou, MD, MS
James Gagnon, PhD
Kevin Jones, MD
Xiaoyang Zhang, PhD
Xiaoxu Yang, PhD