The High-Throughput Genomics (HTG) Shared Resource supports the Agilent Technologies SureSelect platform for exome enrichment projects. An overview of the Agilent exome enrichment products and Frequently Asked Questions are provided below.
Overview of Exome Enrichment Library Preparation Products
Agilent SureSelect XT Human All Exon V7 Enrichment Kit: Covers 35.7 Mb of content with a design size of 48.2 Mb that targets 99.7% of coding exons (213,994) represented in four key databases: RefSeq, GENCODE v24, CCDS, and USCS Known Genes. Pre-enrichment libraries are constructed with the SureSelect Low Input Reagent Kit with a recommended input of 10 to 400 ng of genomic DNA in a volume of 20 to 50 µL. Exome enrichment of the genomic DNA library is accomplished in a hybridization reaction with biotinylated baits from the Human All Exon v7 Enrichment Kit. Library diversity of the exome-enriched library correlates directly with the input quantity of genomic DNA and therefore an increase in duplicate reads may be experienced with the lower end of the recommended input range. A minimum of 30 million read-pairs should be sequenced from each library.
Agilent SureSelect Human All Exon V7 Enrichment Kit: Covers 35.7 Mb of content with a design size of 48.2 Mb that targets 99.7% of coding exons represented in four key databases; RefSeq, GENCODE v24, CCDS, and USCS Known Genes. Pre-enrichment libraries are constructed with the SureSelect Low Input Reagent Kit with a recommended input of 10 to 400 ng of genomic DNA in a volume of 20 to 50 µL. Exome enrichment of genomic DNA libraries is accomplished in a four-plex hybridization reaction (pool of libraries from four different samples) with biotinylated baits from the SureSelect Human All Exon v7 Enrichment Kit. Library diversity of the exome-enriched library correlates directly with the input quantity of genomic DNA and therefore an increase in duplicate reads may be experienced with the lower end of the recommended input range. A minimum of 30 million read-pairs should be sequenced from each library.
Agilent SureSelect Human All Exon v6 + UTR Enrichment Kit: Targets 75 Mb of genomic DNA sequence representing approximately 99% of coding regions from RefSeq, GENCODE, CCDS, and UCSC KNOWN GENES in addition to 5’ and 3’ UTR sequences, miRNAs, and lncRNA sequences. The kit provides sequence representation of 3’ and 5’ UTRs, however, 5’ UTRs tend to often be under-represented. Pre-enrichment libraries are constructed with the SureSelect Low Input Reagent Kit with a recommended input of 10 to 400 ng of genomic DNA in a volume of 20 to 50 µL. Exome enrichment of the genomic DNA library is accomplished in a hybridization reaction with biotinylated baits from the SureSelect Human All Exon v6 + UTR Enrichment Kit. Library diversity of the exome-enriched library correlates directly with the input quantity of genomic DNA and therefore an increase in duplicate reads may be experienced with the lower end of the recommended input range. A minimum of 60 million read-pairs should be sequenced from each library.
Agilent SureSelect Mouse All Exon Enrichment Kit: Covers 49.6 Mb of content designed against the mm9 reference genome that represents 221,784 exons in 24,306 genes. Pre-enrichment libraries are constructed with the SureSelect Low Input Reagent Kit with a recommended input of 10 to 400 ng of genomic DNA in a volume of 20 to 50 µL. Exome enrichment of the genomic DNA library is accomplished in a hybridization reaction with biotinylated baits from the SureSelect Mouse All Exon Enrichment Kit. Library diversity of the exome-enriched library correlates directly with the input quantity of genomic DNA and therefore an increase in duplicate reads may be experienced with the lower end of the recommended input range. A minimum of 40 million read-pairs should be sequenced from each library.
Frequently Asked Questions
1. How many sequence reads are recommended for exome-enriched libraries?
Agilent SureSelect XT Human All Exon V7, Agilent SureSelect Human All Exon V7: A minimum of 30 million read-pairs on a NovaSeq 2 x 150 bp run is recommended when sequencing libraries are constructed with the Agilent SureSelect Human All Exon v7 Enrichment Kit.
Agilent SureSelect Human All Exon v6 + UTR: A minimum of 60 million read-pairs on a NovaSeq 2 x 150 bp run is recommended when sequencing libraries are constructed with the Agilent SureSelect Human All Exon v6 + UTR Enrichment Kit.
Agilent SureSelect Mouse All Exon: A minimum of 40 million read-pairs on a NovaSeq 2 x 150 bp run is recommended when sequencing libraries constructed with the Agilent SureSelect Mouse All Exon Kit.
2. What quantity of DNA is recommended for library preparation?
All Kits: A quantity of 10 to 400 ng of genomic DNA in a volume of 20-50 µL is recommended for preparing an exome enriched library with the Agilent SureSelect product line. Library construction with a quantity of DNA on the high side of this range will result in a more diverse library whereas smaller quantities can result in a higher percent of duplicate reads in the sequence data.
3. How many copies of a haploid human genome are represented in 1 ng of genomic DNA?
All Kits: Each ng of genomic DNA contains approximately 290 haploid copies of the human genome approximate size 3.2 Gb).
4. Can DNA samples purified from formalin fixed paraffin embedded (FFPE) tissues be used for exome enrichment library preparation?
All Kits: The Agilent SureSelect products are compatible with DNA extracted from FFPE tissues. Prior to library preparation, these samples experience a robust de-crosslinking protocol, followed by treatment with the New England BioLabs NEBNext FFPE DNA Repair Mix (cat#M6630) after Covaris fragmentation of the sample. The FFPE Repair Mix is a cocktail of enzymes that includes activities to seal DNA nicks, fill in 5’ over-hangs, polish 3’ ends to a hydroxyl group, fill in short single-stranded DNA gaps of 5-10 bases, and removal and replacement of nucleotides at abasic sites.
5. How should I purify genomic DNA samples?
All Kits: High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504), one of the purification kits from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068), or the Quick-DNA MiniPrep Kit (cat#D3024).
6. How should I purify genomic DNA samples from FFPE tissues?
All Kits: The HTG Shared Resource recommends purifying genomic DNA from FFPE tissues using the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234).
7. Which buffer should be used to elute genomic DNA sample from the spin column?
All Kits: Elution buffer contained in Qiagen (Buffer AE) and Zymo Research genomic DNA purification kits (Zymo DNA Elution Buffer) are compatible with Agilent SureSelect library preparation kits.
8. Should genomic DNA be treated with RNase during the purification process?
All Kits: The Qiagen DNeasy kits allow an optional step to treat samples with RNase (cat#19101) during the DNA purification process. In contrast, Zymo Research documents that reagents supplied with their DNA purification kits should substantially remove RNA unless too much tissue/sample was used during the purification process. Excessive RNA in genomic DNA samples can be inhibitory to downstream enzymatic steps in library preparation as a result of template blocking.
9. How should I store genomic DNA samples?
All Kits: Genomic DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of DNA solutions to the surface of the plastic tube.
10. Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for DNA extraction?
All Kits: The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone protocol for genomic DNA purification is strongly discouraged. The quality of DNA purified by these protocols tend to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process. Reduced efficiency in these steps will result in lower diversity libraries.
11. Does the HTG Shared Resource provide DNA purification services?
All Kits: DNA purification services for samples that will be used with Agilent Exome Enrichment kits can be purified by the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu) or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). In all cases you should request that DNA purification includes RNase treatment of the sample.
12. Is the NanoDrop a good choice for measuring the concentration of a genomic DNA sample?
All Kits: An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid (DNA, RNA, or individual nucleotides) and therefore this assay often does not accurately reflect the concentration of purified genomic DNA which may contain other forms of nucleic acids.
13. How should I measure the concentration of my genomic DNA sample?
All Kits: The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851).
14. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?
All Kits: The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856).
15. Do you recommend using saliva as a source for DNA that will be used in exome enrichment?
All Kits: DNA Genotek, who manufactures the Oragene line of products for genomic DNA purification from saliva, documents that genomic DNA samples purified from human saliva can routinely contain 2 to 40% bacterial DNA. In contrast, bacterial DNA contribution from buccal swabs (66%) and cytobrushes (88%) is even higher. A reduced percentage of human DNA in the exome enrichment process could result in a lower diversity sequencing library.
16. What is the average insert size in an exome enriched library?
All Kits: An average insert size of 170-220 bp is standard for libraries constructed with the SureSelect product line. In contrast to libraries constructed from high molecular weight DNA, libraries prepared from degraded DNA samples sources such as FFPE tissues may exhibit shorter insert sizes.
17. Can I construct my own libraries for sequence analysis on an Illumina instrument?
All Kits: Although the HTG Shared Resource is setup to support all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing, these libraries will experience multiple quality control assays which include a Qubit dsDNA HS Assay, Agilent ScreenTape Assay, and Kapa BioSystems qPCR. Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.
18. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?
All Kits: Adapter dimer products, which appear as 120 to 140 bp bands on a DNA TapeStation Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data delivered from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads from a NovaSeq flow cell.
19. How does the HTG Shared Resource qualify libraries prior to sequencing?
All Kits: Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq, HiSeq 2500 and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.
20. What sequences should be used to trim adapters from the sequence reads?
All Kits: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from Agilent SureSelect libraries:
Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
21. How long will sequencing data from my Exome libraries be available for download on the GNomEx server?
All Kits: Sequencing data will be available on the GNomEx server for a period of approximately six months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Velsera for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Velsera to enable transfer of data. Otherwise, researchers can explore other options for data storage but they should be aware that the GNomEx server is unable to support a solution in excess of six months.
22. Does the HTG Shared Resource provide assistance with analysis of sequence data?
All Kits: The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.
Contact Us
High-Throughput Genomics Director
Brian K. Dalley, PhD
High-Throughput Genomics Associate Director
Opal Allen, PhD
Governance
Huntsman Cancer Institute Senior Director Oversight
Aik Choon Tan, PhD
Faculty Advisory Committee Chair
Jason Gertz, PhD
Faculty Advisory Committee Members
Kaitlin Basham, PhD
Allison Carey, MD, PhD
Vaia Florou, MD, MS
James Gagnon, PhD
Kevin Jones, MD
Xiaoyang Zhang, PhD
Xiaoxu Yang, PhD