Skip to main content

The High-Throughput Genomics (HTG) Shared Resource supports the Qiagen QIAseq miRNA Library Kit for constructing small RNA sequencing libraries. The QIAseq library is constructed with a unique molecular index, which is sequenced during Read 1 and which enables more accurate quantification of miRNA expression levels. QIAseq miRNA libraries are currently sequenced on a HiSeq 2500 instrument using version 4 chemistry, which yields approximately 220 to 270 million reads per lane. Pricing and Frequently Asked Questions for small RNA sequencing projects are provided below.

Small RNA Sequencing Pricing

Frequently Asked Questions

What quantity of RNA is required for library preparation?

A quantity of 1 to 200 ng of total RNA in a volume of 10-12 µL is recommended for constructing a library with the Qiagen QIAseq miRNA Library Kit. Input quantities of total RNA on the low end of this range may result in a higher percent of duplicate sequence reads.

What is the recommended concentration of total RNA for library preparation?

RNA samples that are submitted for library preparation using the Qiagen QIAseq miRNA Library Kit should be provided at a concentration of 1-100 ng/µL.

What quality of RNA (RNA integrity number [RIN]) is recommended for library preparation?

RNA samples with a RIN value between 6.0 and 10.0 are recommended for library preparation with the Qiagen QIAseq miRNA Library Kit. Libraries can be constructed from samples with lower RIN values; however, samples that experienced increased levels of degradation will yield a higher quantity of sequence reads that represent breakdown products of rRNA, mRNA, and other long RNA species.

Does the HTG Shared Resource perform sample quality assays prior to library construction?

The HTG Shared Resource performs a Qubit assay to measure sample concentration and an Agilent ScreenTape Assay to access the quality of RNA samples prior to library preparation. If a sample fails to meet quality specifications for the library prep protocol that was chosen during the experiment order process, the researcher will be contacted prior to proceeding with library preparation.

What purification kits are recommended for extraction of RNA from tissue culture cells?

Total RNA should be purified using a kit that retains both small RNA and large RNA species such as the Qiagen miRNeasy Mini Kit ((cat#2107004) or the Zymo Research Direct-zol RNA MiniPrep Kit (cat# R2050, R2051, R2060, R2061, or similar). In all cases, it is recommended to include on-column DNase treatment to minimize co-purification of DNA in the RNA sample. Zymo Research includes DNase as part of the purification kit whereas Qiagen kits require DNase to be purchased separately (cat#79254).

Should RNA be treated with DNase during the purification process?

The HTG Shared Resource recommends that all RNA samples are treated with DNase during the purification process. Both the Qiagen miRNeasy Mini Kit and the Zymo Research Direct-zol Kit allow for the optional inclusion of applying DNase to the spin column while purifying an RNA sample.

Does the HTG Shared Resource provide access to a Qiagen TissueLyzer?

A Qiagen TissueLyzer LT is available at the HTG Shared Resource for extraction of RNA from tissue samples. The TissueLyzer LT can simultaneously disrupt up to 12 tissues by vigorously shaking the samples in the presence of RNA purification buffer containing a stainless-steel bead. A carrying bag is available to transport the instrument to your lab.

What buffer should be used to elute RNA from a spin column?

RNA should be eluted from spin columns or diluted to a lower concentration using RNase-free water.

Should I add carrier RNA/DNA when purifying low input samples?

We recommend avoiding the addition of carrier RNA/DNA when purifying nucleic acid samples. Carrier products added to a sample can function as template during the library preparation process and substantially contribute to the sequence reads. These products also interfere with accurate assessment of the concentration and quality of the target RNA sample.

How should I store purified RNA samples?

RNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute RNA solutions to the surface of the plastic tube.

Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for RNA extraction?

The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone method for RNA purification is strongly discouraged. The quality of RNA purified by these protocols tends to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process.

Does the HTG Shared Resource provide RNA purification services?

The HTG Shared Resource does not provide RNA purification services. RNA Purification services can be obtained from the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu) or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). In all cases you should request that RNA purification includes DNase treatment of the sample and you should communicate that you require a purification kit that will enable the isolation of miRNA in addition to other RNA species.

Is the NanoDrop a good choice for measuring the concentration of an RNA sample?

An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid including DNA, RNA, small nucleic acid fragments, or nucleotides. The NanoDrop may provide useful information when screening the concentration of RNA samples that are above 10 ng/µL if the A260/230 ratio is between 1.6 and 2.4. However, the use of fluorescent dyes such as those available for use with the Qubit, provide a more accurate solution for measuring the concentration of an RNA sample.

How should I measure the concentration of my total RNA samples?

The concentration of RNA samples should be measured using either the Qubit RNA Broad Range Assay Kit (Fisher cat#Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat#Q32852).

Does the HTG Shared Resource provide researchers with access to a Qubit instrument?

The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Required reagents for measuring RNA concentration include either the Qubit RNA Broad Range Assay Kit (Fisher cat#Q10210) or the Qubit RNA High Sensitivity Assay (Fisher cat#Q32852) in addition to Qubit Assay Tubes (Fisher cat#Q32856).

How many reads are recommended for each small RNA library?

It is recommended to target a minimum of 10–15 million reads per sample for libraries constructed with the Qiagen QIAseq miRNA Library Kit.

What species of RNA are included in a library constructed with the Qiagen QIAseq miRNA Library Kit?

The QIAseq miRNA Library Kit has been optimized to prepare libraries from RNA species containing a 5’-phosphate and 3’-hydroxyl group that are in the size range of 12 to 40 bases. Breakdown products from large RNA species such as rRNA and mRNA which contain the appropriate end modifications may also be present in the library.

Can the Qiagen QIAseq miRNA Library Kit be used to perform both miRNA and mRNA expression profiling?

The construction of miRNA libraries with the Qiagen QIAseq miRNA Library Kit includes the direct ligation of adapters to the ends of RNA molecules using RNA ligases. This step requires the presence of a 5’ phosphate and 3’ hydroxyl group which are common to most mature miRNA and piRNA molecules. At the same time, this strategy minimizes the background from other RNA species which often do not possess the required phosphorylation pattern. Therefore, the Qiagen QIAseq Kit cannot be used for constructing mRNA-centric sequencing libraries.

Can I construct my own libraries for sequence analysis on an Illumina sequencer?

Although the HTG Shared Resource is set up to support all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing, these libraries will experience multiple quality control assays, which include a Qubit dsDNA HS Assay, Agilent ScreenTape Assay, and Kapa BioSystems qPCR. Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.

Should I be concerned if adapter dimer products are present in the small RNA library that I constructed?

Adapter dimer products, which appear as 120 to 140 bp bands on a DNA TapeStation Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain cDNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data delivered from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads from a NovaSeq flow cell.

How does the HTG Shared Resource qualify libraries prior to sequencing?

Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq, HiSeq 2500 and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.

What sequences are used for adapter trimming of QIAseq small RNA libraries?

The Read 1 sequence of a library constructed with the Qiagen QIAseq miRNA Library Kit may include the following sequences: miRNA sequence, a 19 base Qiagen adapter sequence, a 12 base unique molecular index (UMI), a 34 base Illumina adapter sequence, and a 6 base p7 index. Adapter sequences need to be trimmed prior to alignment.

  • TAGCTTATCAGACTGATGTTGA (example of miRNA sequence)
  • AACTGTAGGCACCATCAAT (19 base Qiagen adapter)
  • NNNNNNNNNNNN (12 base random sequence representing the UMI)
  • AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina adapter sequence)
  • ATCACG (example of i7 index sequence)

How long will sequencing data from genomic DNA libraries be available for download on the GNomEx server?

Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Velsera for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Velsera to enable transfer of data. Otherwise, researchers can explore other options for data storage, but they should be aware that the GNomEx server is unable to support a solution in excess of 6 months.

Does the HTG Shared Resource provide assistance with analysis of sequence data?

The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.

Contact Us

High-Throughput Genomics Director
Brian K. Dalley, PhD

High-Throughput Genomics Associate Director
Opal Allen, PhD

Submit Contact Form

Governance

Huntsman Cancer Institute Senior Director Oversight
Aik Choon Tan, PhD

Faculty Advisory Committee Chair
Jason Gertz, PhD

Faculty Advisory Committee Members
Kaitlin Basham, PhD
Allison Carey, MD, PhD
Vaia Florou, MD, MS
James Gagnon, PhD
Kevin Jones, MD
Xiaoyang Zhang, PhD
Xiaoxu Yang, PhD