DNA Methylation

The High-Throughput Genomics (HTG) Shared Resource supports the Illumina TruSeq Methyl Capture Epic Library Prep and the Agilent Technologies SureSelect Methyl-Seq product line for targeted enrichment and sequencing of differentially methylated regions of the human or mouse genomes. The Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit is also supported which enables whole genome methylation analysis. An overview of the supported library preparation kits and Frequently Asked Questions relevant to these products are provided below.

View Pricing
Frequently Asked Questions


Overview of Methyl-Seq Library Preparation Products

Illumina TruSeq Methyl Capture EPIC Library Prep Kit: Enables the enrichment of 107 Mb of human genomic DNA content that includes 3,340,894 CpG sites, 345,327 WGBS DMRs and 141,527 GenCode Promoters in addition to Open Chromatin sites, TFBs, MEDs, FANTOM5 enhancers, and CTCF ChIP peaks. A recommended input of 500 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized in a four-plex reaction (pool of libraries from four different samples) with a set of biotinylated baits that represent methylation sensitive regions of the genome. Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Dual-indexed libraries constructed with the TruSeq Methyl Capture EPIC Library Prep Kit can be sequenced on an Illumina NovaSeq. A minimum of 60 million read-pairs should be sequenced from each library.

Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep Kit: Enables the enrichment of 84 Mb of human genomic DNA content that includes 3.7 million CpGs in addition to GenCode promoters and DMRs. A recommended input of 500-3,000 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized with a set of biotinylated baits that represent methylation sensitive regions of the genome. Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Libraries constructed with the Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep Kit contain a single indexed adapter which performs best on a HiSeq 2500 Paired-End sequence run (2 x 125 bp). A minimum of 60 million read-pairs should be sequenced from each library.

Agilent SureSelect Mouse Methyl-Seq Target Enrichment Library Prep Kit: Enables the enrichment of 109 Mb of mouse genomic DNA content that includes CpGs, GenCode promoters and DMRs. A recommended input of 500-3,000 ng of genomic DNA is mechanically sheared with a Covaris AFA instrument and a PCR-free library is constructed and hybridized with a set of biotinylated baits that represent methylation sensitive regions of the genome. Following hybridization, the enriched library is treated with bisulfite to reveal single base resolution of differentially methylated cytosine residues. Libraries constructed with the Agilent SureSelect Human Methyl-Seq Target Enrichment Library Prep kit contain a single indexed adapter which performs best on a HiSeq 2500 Paired-End sequence run (2 x 125 bp). A minimum of 60 million read-pairs should be sequenced from each library.

Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit: Enables the construction of sequencing libraries for genome-wide differential methylation analysis. The recommended input for library preparation is 1 to 100 ng of genomic DNA which should be delivered in a volume of 15 to 30 µL. The Swift Kit is compatible with DNA derived from formalin fixed paraffin embedded (FFPE) tissues in addition to high quality DNA sources. Following Covaris shearing and bisulfite treatment of genomic DNA samples, a short tail is added to the 3’ end of single-stranded DNA molecules that enables the addition of adapters required for sequencing on an Illumina instrument. Cost-effective sequencing of the dual-indexed libraries constructed with the Accel-NGS Methyl-Seq kit can be performed on the Illumina NovaSeq.


Frequently Asked Questions

1. What quantity of DNA is recommended for library preparation?

Agilent SureSelect Human Methyl-Seq Target, Agilent SureSelect Mouse Methyl-Seq Target: A quantity of 500 to 3000 ng of genomic DNA in a volume of 20-50 µL is recommended for preparing a library with either human or mouse versions of the Agilent SureSelect Methyl-Seq Enrichment Kit.

Illumina TruSeq Methyl Capture EPIC: A quantity of 500 ng of genomic DNA in a volume of 20-50 µL is recommended for preparing a library with the Illumina TruSeq Methyl Capture EPIC Library Kit. An equal quantity of DNA should be submitted for all samples in the same experiment order so that libraries can be normalized prior to enrichment.

Swift Biosciences Accel-NGS Methyl-Seq DNA: A quantity of 1 to 100 ng of genomic DNA in a volume of 15 to 30 µL is recommended for preparing a library with the Swift Biosciences Accel-NGS Methyl-Seq DNA Library Prep Kit. Library construction with a quantity of DNA on the high side of this range will result in a more diverse library whereas smaller quantities can result in a higher percent of duplicate reads in the sequence data.


2. How many copies of a haploid human genome are represented in 1 ng of genomic DNA?

All Kits: Each ng of genomic DNA contains approximately 290 haploid copies of the human genome approximate size 3.2 Gb).


3. Are DNA samples purified from Formalin Fixed Paraffin Embedded (FFPE) tissues compatible with Methyl-seq library preparation?

Illumina TruSeq Methyl Capture EPIC, Agilent SureSelect Human Methyl-Seq Target, Agilent SureSelect Mouse Methyl-Seq Target: DNA samples purified from FFPE tissue are not compatible with methyl-seq enrichment kits including those manufactured by Agilent and Illumina.

Swift Biosciences Accel-NGS Methyl-Seq DNA: DNA samples purified from FFPE tissues are compatible with the Swift Biosciences Accel-NGS Methyl-Seq DNA Library Prep kit which supports construction of libraries for whole methylome analysis.


4. How should I purify genomic DNA samples?

All Kits: High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504), one of the purification kits from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068), or the Quick-DNA MiniPrep Kit (cat#D3024).


5. How should I purify genomic DNA samples from Formalin Fixed Paraffin Embedded (FFPE) tissues?

All Kits: The HTG Shared Resource recommends purifying genomic DNA from FFPE tissues using the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234). The Biorepository and Molecular Pathology Shared Resource in HCI provides DNA purification services from FFPE tissues (contact john.oshea@hci.utah.edu).


6. Which buffer should be used to elute genomic DNA sample from the spin column?

All Kits: Elution buffer contained in Qiagen (Buffer AE) and Zymo Research genomic DNA purification kits (Zymo DNA Elution Buffer) are compatible with methyl-seq library kits supported by the HTG Shared Resource.


7. Should genomic DNA be treated with RNase during the purification process?

All Kits: The Qiagen DNeasy kits allow an optional step to treat samples with RNase (cat#19101) during the DNA purification process. In contrast, Zymo Research documents state that reagents supplied with their DNA purification kits should substantially remove RNA unless too much tissue/sample was used during the purification process. Excessive RNA in genomic DNA samples can be inhibitory to downstream enzymatic steps in library preparation as a result of template blocking.


8. How should I store genomic DNA samples?

All Kits: Genomic DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute DNA solutions to the surface of the plastic tube.


9. Do you recommend using either Trizol or phenol/chloroform as a stand-alone reagent for DNA extraction?

All Kits: The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone protocol for genomic DNA purification is strongly discouraged. The quality of DNA purified by these protocols tend to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process. Reduced efficiency in these steps will result in lower diversity libraries.


10. Does the HTG Shared Resource provide DNA purification services?

All Kits: DNA purification services for samples that will be used with Methyl-Seq library preparation kits is available from either the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu) or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). In all cases you should request that DNA purification includes RNase treatment of the sample. The HTG Shared Resource does not provide purification services.


11. Is the NanoDrop a good choice for measuring the concentration of a genomic DNA sample?

All Kits: An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid (DNA, RNA, small nucleic acid fragments, and nucleotides) and therefore this assay often does not accurately reflect the concentration of purified genomic DNA which may contain other forms of nucleic acids.


12. How should I measure the concentration of my genomic DNA sample?

All Kits: The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851).


13. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?

All Kits: The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856).


14. What is the average insert size in a methyl-seq library?

Illumina TruSeq Methyl Capture EPIC, Agilent SureSelect Human Methyl-Seq Target, Agilent SureSelect Mouse Methyl-Seq Target: Libraries constructed with either the Illumina or Agilent methyl-seq enrichment kits contain inserts that span from approximately 100-400 bp with an average insert size of approximately 160 bp.

Swift Biosciences Accel-NGS Methyl-Seq: Libraries constructed with either the Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit contains inserts that span from approximately 100-400 bp with an average insert size of approximately 160 bp. In contrast to libraries constructed from high molecular weight DNA, libraries prepared from degraded DNA samples sources such as FFPE tissues may exhibit shorter insert sizes.


15. Can I construct my own libraries for sequence analysis on an Illumina instrument?

All Kits: Although the HTG Shared Resource is setup to support all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing, these libraries will experience multiple quality control assays which include a Qubit dsDNA HS Assay, Agilent ScreenTape Assay, and Kapa BioSystems qPCR. Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.


16. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?

All Kits: Adapter dimer products, which appear as 120 to 140 bp bands on a DNA TapeStation Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data delivered from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads from a NovaSeq flow cell.


17. How does the HTG Shared Resource qualify libraries prior to sequencing?

All Kits: Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq, HiSeq 2500, and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.


18. How many sequence reads are recommended for exome-enriched libraries?

Agilent SureSelect Human Methyl-Seq Target, Agilent SureSelect Mouse Methyl-Seq Target: A minimum of 60 million read-pairs on a 2 x 125 bp run on a HiSeq 2500 is recommended when sequencing libraries are constructed with Agilent SureSelect Methyl-Seq Enrichment Kits.

Illumina TruSeq Methyl Capture EPIC: A minimum of 60 million read-pairs on a 2 x 150 bp run on aNovaSeq is recommended when sequencing libraries are constructed with the Illumina TruSeq Methyl Capture EPIC Library Kit.

Swift Biosciences Accel-NGS Methyl-Seq DNA: A minimum of 300 million read-pairs on a 2 x 150 bp run on a NovaSeq is recommended for human whole methylome libraries constructed with the Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit.


19. What sequences should be used to trim adapters from the sequence reads?

Illumina TruSeq Methyl Capture EPIC, Agilent SureSelect Human Methyl-Seq Target, Agilent SureSelect Mouse Methyl-Seq Target: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with Illumina or Agilent Methyl-Seq Enrichment Kits:

  • Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Swift Biosciences Accel-NGS Methyl-Seq DNA: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from Swift Biosciences Accel-NGS Methyl-Seq DNA Libraries:

  • Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
  • Following adapter trimming from the 3’ end of Swift Biosciences Accel-NGS Methyl-Seq DNA Library Kit, it is recommended to trim an additional 10 bases from the end of Read 1 and the beginning of Read 2 to remove the Adaptase tail that is added during library construction.

20. How long will sequencing data from my Methyl-Seq libraries be available for download on the GNomEx server?

All Kits: Sequencing data will be available on the GNomEx server for a period of approximately 6 months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Seven Bridges for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Seven Bridges to enable transfer of data. Otherwise, researchers can explore other options for data storage but they should be aware that the GNomEx server is unable to support a solution in excess of six months.


Does the HTG Shared Resource provide assistance with analysis of sequence data?

All Kits: The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.

Contact Us

High-Throughput Genomics Director
Brian K. Dalley, PhD
brian.dalley@hci.utah.edu
801-585-7192

Governance

HCI Senior Director Oversight
Alana Welm, PhD

Faculty Advisory Committee Chair
Katherine Varley, PhD

Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD