DNA Sequencing

The High-Throughput Genomics (HTG) Shared Resource supports whole genome sequencing on the Illumina platform enabling diverse levels of sequencing outputs and run types to support a cost-effective solution for various scales and types of projects. Library preparation options are available that include support for low input, PCR-free, ssDNA and ultra-high molecular weight DNA. An overview of the library preparation kits supported for DNA sequencing and associated Frequently Asked Questions are provided below.

View Pricing
Frequently Asked Questions


Overview of DNA Library Preparation Kits

Nextera DNA Flex Library Prep Kit: Enables the construction of genomic DNA sequencing libraries with an average insert size of approximately 450 bp with minimal PCR amplification. The recommended input for library construction is 1 to 200 ng of genomic DNA which should be delivered in a volume of 15 to 30 µL. When preparing DNA samples for library preparation that will be performed with the Nextera DNA Flex Library Prep Kit, it is recommended to minimize the molarity of EDTA in the sample as a means to avoid the inhibition of downstream enzymatic reactions. Cost effective sequencing of libraries constructed with the Nextera DNA Flex Library Prep Kit can be performed on the Illumina NovaSeq.

10X Genomics Chromium Genome Library Kit: Uses a microfluidic chip to partition high molecular weight genomic DNA fragments and amplify short segments (400 to 800 bp) such that all molecules derived from the same partition will share a common molecular barcode. Following sequence analysis on an Illumina NovaSeq, the short-read data generated from the libraries provides linked-read information that associates individual sequence reads back to a partitioned molecule of high molecular weight DNA. This sequencing strategy provides a solution to call and phase major classes of structural variants (deletions, inversions, translocations and insertions) in addition to providing high quality genomic sequencing coverage to identify single nucleotide polymorphisms. The recommended DNA input for library construction using the 10X Genomics Chromium Genome Solution is 1 to 2 ng of high molecular weight genomic DNA. A quantity of 500 million read-pairs of sequence data is recommended for human whole genome re-sequencing projects.

Illumina TruSeq DNA Nano Library Prep Kit: Enables the construction of genomic DNA sequencing libraries with an average insert size of approximately 400 to 450 bp. The recommended input for library construction is 100 ng of genomic DNA which should be delivered in a volume of 15-50 ul. Lower quantities of DNA can also be used with this kit. Cost effective sequencing of libraries constructed with the Illumina TruSeq DNA Nano Library Prep kit can be performed on the Illumina NovaSeq.

Illumina TruSeq DNA PCR-Free Library Prep Kit: Enables the construction of genomic DNA sequencing libraries with an average insert size of approximately 450 bp in the absence of PCR amplification. The recommended input for library construction is 1,000 to 2,000 ng of genomic DNA which should be delivered in a volume of 15 to 50 ul. DNA purified by organic extraction does not work well with this kit.

Swift Biosciences Accel-NGS 1S Plus DNA Library Kit: Enables the construction of genomic DNA sequencing libraries from either single-stranded and double-stranded DNA following a strand denaturation reaction. Following mechanical shearing and heat denaturation, a short tail is added to the 3’ end of DNA molecules that enables the addition of adapter sequences. Libraries constructed using this kit can be sequenced on the Illumina sequencing instrument of choice.


Frequently Asked Questions

1. What quantity of DNA is recommended for library preparation?

Nextera DNA Flex: A quantity of 1 to 200 ng of genomic DNA in a volume of 10-30 µL is recommended for constructing a genomic DNA library with the Nextera DNA Flex Library Prep kit. Library construction with a quantity of DNA on the high side of this range will result in a more diverse library whereas smaller quantities can result in a higher percent of duplicate reads in the sequence data.

10X Genomics Chromium Genome: A quantity of 1 to 2 ng of high molecular weight genomic DNA in a volume of 20 µL is recommended for constructing a genomic DNA library with the 10X Genomics Chromium Genome Library Prep Kit.

Illumina TruSeq DNA Nano: A quantity of 100 to 200 ng of genomic DNA in a volume of 15-50 µL is recommended for constructing a genomic DNA library with the Illumina TruSeq DNA Nano Library Prep kit.  Libraries can be constructed with lower quantities of genomic DNA, however, higher quantities will result in a more diverse library whereas smaller quantities can result in a higher percentage of duplicate reads in the sequence data.

Illumina TruSeq DNA PCR-Free: A quantity of 1,000 to 2,000 ng of genomic DNA in a volume of 15-50 µL is recommended for constructing a genomic DNA library with the Illumina TruSeq DNA PCR-Free Library Prep kit. Approximately 10-20% of DNA fragments will successfully have adapters ligated to both ends of the fragmented DNA molecule.

Swift Biosciences Accel-NGS 1S Plus DNA: A quantity of 10 to 250 ng of genomic DNA in a volume of 15-20 µL is recommended for constructing a genomic DNA library with the Swift Biosciences Accel-NGS 1S Plus DNA Library Kit.


2. How many copies of a haploid human genome are represented in 1ng of genomic DNA?

All Kits: Each ng of genomic DNA contains approximately 290 haploid copies of the human genome approximate size 3.2 Gb.


3. How does the Nextera DNA Flex Small Genomes Library Prep protocol differ from the standard Nextera DNA Flex Library Prep?

Nextera DNA Flex: The Nextera DNA Flex Small Genomes Library Prep has been designed to provide sufficient unique sequencing coverage for DNA samples derived from organisms with genomes smaller than 1GB. The Small Genomes library option is only available for high-throughput orders consisting of 40 or more samples.


4. How does library prep with DNA samples from formalin fixed paraffin embedded (FFPE) tissues differ from the standard protocol?

Illumina TruSeq DNA Nano: DNA extracted from FFPE tissues frequently remains partially crosslinked which can inhibit efficient library preparation. Therefore, these samples experience a robust de-crosslinking protocol, followed by treatment with the New England BioLabs NEBNext FFPE DNA Repair Mix (cat#M6630) after Covaris fragmentation of the sample. The FFPE Repair Mix is a cocktail of enzymes that includes activities to seal DNA nicks, fill in 5’ over-hangs, polish 3’ ends to a hydroxyl group, fill in short single-stranded DNA gaps of 5-10 bases, and removal and replacement of nucleotides at abasic sites. Library preparation for DNA samples from FFPE tissues is currently supported with the TruSeq DNA Nano Library Prep Kit.


5. How should I purify genomic DNA samples?

Nextera DNA Flex, Illumina TruSeq DNA Nano, Illumina TruSeq DNA PCR-Free, Swift Biosciences Accel-NGS 1S Plus DNA: High quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue kit (cat#69504) or one of the purification kits from Zymo Research including the Quick-DNA Plus MiniPrep kit (cat#D4068) or the Quick-DNA MiniPrep Kit (cat#D3024).

10X Genomics Chromium Genome: The preparation of ultra-high molecular weight DNA is critical to achieve a successful outcome with the 10X Genomics Chromium Genome Library preparation. DNA extraction protocols recommended by 10X Genomics includes the Qiagen MagAttract HMW DNA Kit (cat#67563), a salting out method for DNA extraction from cells, and a protocol that includes nuclei purification with the Sigma Nuclei PURE Prep Kit (cat#NUC201-1KT). 10X genomics has prepared technical notes and full protocols for each of these methods that are available. These methods should be carefully followed if you are purifying DNA for use with the 10X platform. The HTG Shared Resource does provide DNA purification services for DNA samples that will be used with the 10X Genomics platform.


6. How should I purify genomic DNA samples from FFPE tissues?

Illumina TruSeq DNA Nano: The High-Throughput Genomics Shared Resource recommends purifying genomic DNA from FFPE tissues using the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234). The Biorepository and Molecular Pathology Shared Resource also provided services for purification of DNA from FFPE tissues.


7. Which buffer should be used to elute genomic DNA sample from a spin column?

Illumina TruSeq DNA Nano, Illumina TruSeq DNA PCR-Free, Swift Biosciences Accel-NGS 1S Plus DNA: Elution buffer contained in Qiagen and Zymo Research genomic DNA purification kits (Qiagen Buffer AE or Zymo Research DNA Purification Buffer) containing 1 mM EDTA is acceptable when libraries are constructed with the Illumina TruSeq DNA Nano Library Prep Kit, the Illumina TruSeq DNA PCR-Free Library Prep Kit or the Swift Accel-NGS 1S Plus Library Kit. However, if you are potentially also considering library construction with the Nextera DNA Flex Library Prep kit, it is recommended to elute samples with a buffer such as Qiagen Buffer EB (cat# 19086) which is composed of 10 mM Tris pH 8.5 or a low-EDTA buffer such as Teknova DNA Suspension Buffer (cat#T0223) which is composed of 10 mM Tris, 0.1 mM EDTA pH 8.0.

Nextera DNA Flex: Elution buffer contained in Qiagen and Zymo Research genomic DNA purification kits (Qiagen Buffer AE or Zymo Research DNA Purification Buffer) contain 1 mM EDTA which can be inhibitory to enzymes used in the Nextera DNA Flex kit. The Nextera enzyme used in this kit is sensitive to EDTA and we recommend substituting either Qiagen Buffer EB (cat# 19086) which is composed of 10 mM Tris pH 8.5 or a low-EDTA buffer such as Teknova DNA Suspension Buffer (cat#T0223) which is composed of 10 mM Tris, 0.1 mM EDTA pH 8.0.

10X Genomics Chromium Genome: DNA for 10X Genomics library preparation is eluted in Buffer AE (10 mM Tris, 0.5 mM EDTA when using the Qiagen MagAttract purification kit.


8. Should genomic DNA be treated with RNase during the purification process?

All Kits: The Qiagen DNeasy kits allow an optional step to treat samples with RNase (cat#19101) during the DNA purification process. In contrast, Zymo Research documents that reagents supplied with their DNA purification kits should substantially remove RNA unless quantities of tissue/sample exceed specifications during the purification process. Excessive RNA in genomic DNA samples can be inhibitory to downstream enzymatic steps in library preparation as a result of template blocking.


9. How should I store dilute genomic DNA samples?

All Kits: Genomic DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat# 022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C) which minimize the non-specific binding of dilute DNA solutions to the surface of the plastic tube.


10. Is it acceptable to purify genomic DNA with phenol/chloroform or other organic extraction methods?

All Kits: The use of organic extraction reagents such as Trizol or phenol/chloroform as a stand-alone protocol for genomic DNA purification is strongly discouraged. The quality of DNA purified by these protocols tend to be lower due to organic carry-over and the co-precipitation of biomolecules which are inhibitory to downstream enzymatic steps in the library preparation process.


11. Does the HTG Shared Resource provide DNA purification services?

Nextera DNA Flex, Illumina TruSeq DNA Nano, Illumina TruSeq DNA PCR-Free, Swift Biosciences Accel-NGS 1S Plus DNA: DNA purification services for samples that will be used with the TruSeq or Swift Library preparation kits can be obtained from either the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu) or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). In all cases you should request that DNA purification includes RNase treatment of the sample.

10X Genomics Chromium Genome: The HTG Shared Resource provides DNA purification services using the Qiagen MagAttract Purification Kit for samples that will be used with the 10X Genomics Chromium Genome Library Prep Kit.


12. Is the NanoDrop a good choice for measuring the concentration of a genomic DNA sample?

All Kits: An A260 measurement on a NanoDrop reflects absorbance by any form of nucleic acid (DNA, RNA, short nucleic acid fragments or nucleotides) and therefore this assay often does not accurately reflect the concentration of sample of purified genomic DNA which may contain other forms of nucleic acids.


13. How should I measure the concentration of my genomic DNA sample?

All Kits: The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851).


14. Does the HTG Shared Resource provide researchers with access to a Qubit instrument?

All Kits: The HTG Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat# 32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856).


15. Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?

All Kits: DNA Genotek, who manufactures the Oragene line of products for genomic DNA purification from saliva, documents that genomic DNA samples purified from human saliva can routinely contain 2 to 40% bacterial DNA. In contrast, bacterial DNA contribution from buccal swabs (66%) and cytobrushes (88%) is even higher. Therefore, a research lab that plans to use saliva as a source for genomic DNA samples should also plan to sequence the resulting libraries at a higher read-depth as a means to achieve adequate coverage of the human genome that contains a background of bacterial DNA.


16. What is the average insert size of a DNA library?

Nextera DNA Flex: The average insert size of a library constructed with the Nextera DNA Flex Library Prep kit is approximately 400 to 500 bp.

10X Genomics Chromium Genome: The average insert size of a library constructed with the 10X Genomics Chromium Genome Library Prep Kit is approximately 400 to 800 bp.

Illumina TruSeq DNA Nano: Genomic DNA is mechanically sheared to an average size of 400 to 500 bp when constructing libraries with the TruSeq DNA Nano kit. DNA samples purified from formalin fixed paraffin embedded (FFPE) tissues can be somewhat shorter than this size range due to fragmentation of DNA during the formalin preservation process. Shorter insert sizes can be accommodated if the experimental procedure requires deviation from the standard size.

Illumina TruSeq FCR-Free: Genomic DNA is mechanically sheared to an average size of 400 to 500 bp when constructing libraries with the TruSeq DNA PCR-free kit.

Swift Biosciences Accel-NGS 1S Plus DNA: The insert size of libraries constructed with the Swift Biosciences Accel-NGS 1S Plus DNA Library Kit can range from 200 to 600 bp depending on DNA fragmentation and size selection parameters.


17. Can I construct my own libraries for sequence analysis on an Illumina instrument?

All Kits: Although the HTG Shared Resource is setup to support all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing, these libraries will experience multiple quality control assays which include a Qubit dsDNA HS Assay, Agilent ScreenTape Assay, and Kapa BioSystems qPCR. Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.


18. Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?

All Kits: Adapter dimer products, which appear as 120 to 140 bp bands on a DNA TapeStation Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data delivered from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in adapter dimers contributing as much as 65% of the sequence reads from a NovaSeq flow cell.


19. How does the HTG Shared Resource qualify libraries prior to sequencing?

All Kits: Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq, HiSeq 2500 and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the Kapa Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of library preparation when the HTG Shared Resource constructs the library. Alternatively, an additional fee is charged per sample when researchers construct libraries within their own lab.


20. How many sequence reads are recommended for human whole genome sequencing?

Nextera DNA Flex, Illumina TruSeq DNA Nano, Illumina TruSeq DNA PCR-Free, Swift Biosciences Accel-NGS 1S Plus DNA: A quantity of 300 million read-pairs on a 2 x 150 bp run on a NovaSeq will deliver 90 billion bases of sequence data which represents approximately 30x coverage of the human genome.

10X Genomics Chromium Genome: 10X Genomics recommends a 50x sequencing depth for human whole genome libraries constructed with the Chromium Genome Library Prep kit which will enable detection of single nucleotide polymorphisms in addition to structural modifications. A quantity of 500 million read-pairs on a 2 x 150 bp run on a NovaSeq will deliver 150 billion bases of sequence data which represents approximately 50x coverage of the human genome.


21. What sequences should be used to trim adapters from the sequence reads?

Illumina TruSeq DNA Nano, Illumina TruSeq DNA PCR-Free: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from 10X Genomics Chromium Genome libraries, TruSeq DNA Nano libraries and TruSeq DNA PCR-free libraries:

  • Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Nextera DNA Flex: The following sequence can be used for trimming adapters from the 3’ end of sequence reads in both Read 1 and Read 2 of Nextera DNA Flex libraries:

  • Read 1 and Read 2: CTGTCTCTTATACACATCT

Swift Biosciences Accel-NGS 1S Plus DNA: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from Swift BioSciences Accel-NGS 1S Plus DNA Libraries:

  • Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
  • Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Following adapter trimming from the 3’ end of Swift Accel-NGS 1S Plus DNA libraries, it is recommended to trim an additional 10 bases from the end of Read 1 and the beginning of Read 2 to remove the Adaptase tail that is added during library construction.


22. How long will sequencing data from my genomic DNA libraries be available for download on the GNomEx server?

All Kits: Sequencing data will be available on the GNomEx server for a period of approximately six months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Seven Bridges for long-term storage. Please contact the Bioinformatics Shared Resource for information on creating an account on Seven Bridges. Otherwise, researchers can explore other options for data storage but they should be aware that the GNomEx server is unable to support a solution in excess of six months.


23. Does the HTG Shared Resource provide assistance with analysis of sequence data?

All Kits: The HTG Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.

Contact Us

High-Throughput Genomics Director
Brian K. Dalley, PhD
brian.dalley@hci.utah.edu
801-585-7192

Governance

HCI Senior Director Oversight
Alana Welm, PhD

Faculty Advisory Committee Chair
Katherine Varley, PhD

Faculty Advisory Committee Members
Richard Clark, PhD
Jason Gertz, PhD
Christopher Gregg, PhD
Mei Koh, PhD
Philip Moos, PhD
Andrew Post, MD, PhD
Sean Tavtigian, PhD
Joseph Yost, PhD