HTG DNA Sequencing

What quantity of DNA is recommended for library preparation?

Illumina DNA Prep: A quantity of 25–200 ng in a volume of 10–30 ul is recommended for constructing a genomic DNA library with the Illumina DNA Prep Kit from human gDNA samples and other large complex genomes. Lower quantities of DNA (1–10 ng) are also compatible with this kit and diverse libraries from organisms with small genomes can be constructed with these lower quantities of input DNA.

TruSeq DNA Nano Library Prep Kit: A quantity of 100–200 ng of genomic DNA in a volume of 15–50 µL is recommended for constructing a genomic DNA library with the TruSeq DNA Nano Library Prep Kit. Libraries can also be successfully constructed with much lower quantities (10–50 ng), however, libraries with low input typically yield a higher percentage of duplicate reads.

TruSeq DNA PCR-Free Library Prep: A quantity of 1000–2000 ng of genomic DNA in a volume of 15–50 µL is recommended for constructing a genomic DNA library with the TruSeq DNA PCR-Free Library Prep Kit. Approximately 10–20% of DNA fragments will successfully have adapters ligated to both ends of the fragmented DNA molecule.

NEBNext Ultra II DNA Library Prep Kit: A quantity of 5–200 ng of genomic DNA in a volume of 10–30 ul is recommended for constructing a genomic DNA library with the Illumina DNA Prep Kit. Library construction with higher quantities of DNA input will result in a more diverse library, whereas smaller quantities can result in a higher percent of duplicate reads in the sequence data.

How many copies of a haploid human genome are represented in 1ng of genomic DNA?

All Kits: Each ng of genomic DNA contains approximately 290 haploid copies of the human genome approximate size 3.2 Gb.

How does the Illumina DNA Prep for Small Genomes protocol differ from the standard Illumina DNA Prep protocol?

Illumina DNA Prep for Small Genomes: The Illumina DNA Prep for Small Genomes has been designed to provide a diverse sequencing library for DNA samples derived from organisms with genomes smaller than 1 Gb by reducing the reaction size. The Small Genomes library option is only available for orders consisting of 20 or more samples.

Is DNA that has been purified from FFPE tissues compatible with library preparation?

All Kits: DNA extracted from FFPE tissues is compatible with the Illumina DNA Prep, the Illumina TruSeq DNA Nano Kit, and the NEBNext Ultra II DNA Library Prep Kit following decrosslinking and FFPE repair. However, higher quantities of input DNA may be required for constructing a diverse library with FFPE samples. DNA extracted from FFPE tissues is not compatible with PCR-free library protocols.

Describe the methods used for FFPE repair.

All Kits: DNA extracted from FFPE tissues frequently remains partially crosslinked, which can inhibit efficient library preparation. Therefore, these samples are treated with an additional, lengthened de-crosslinking protocol, which is followed by treatment with the New England Biolabs NEBNext FFPE DNA Repair Mix (cat#M6630). The FFPE Repair Mix is a cocktail of enzymes that includes activities to seal DNA nicks, fill in 5’ over-hangs, polish 3’ ends to a hydroxyl group, fill in short single-stranded DNA gaps of 5–10 bases, and removal and replacement of nucleotides at abasic sites. FFPE repair prior to library preparation is available for an additional fee.

How should I purify genomic DNA samples?

All Kits: High-quality genomic DNA can be purified using a spin column such as those available in the Qiagen DNeasy Blood and Tissue Kit (cat#69504) or one of the purification kits from Zymo Research, including the Quick-DNA Plus MiniPrep Kit (cat#D4068) or the Quick-DNA MiniPrep Kit (cat#D3024).

How should I purify genomic DNA samples from FFPE tissues?

All Kits: The High Throughput Genomics Shared Resource recommends purifying genomic DNA from FFPE tissues using the Promega ReliaPrep FFPE DNA MiniPrep System (cat#A2351) or the Qiagen AllPrep DNA/RNA FFPE Kit (cat#80234).

Which buffer should be used to elute genomic DNA sample from a spin column?

All Kits: Elution buffers included for DNA extraction with the Qiagen and Zymo Research consist of Qiagen Buffer AE (10 mM Tris-HCl, 0.5 mM EDTA, pH 9.0 ) and Zymo Research DNA Elution Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.5), respectively. We recommend low levels of EDTA (0.1 mM or lower) when library preparation is performed with the Illumina DNA Prep Kit as the tagmentation enzyme is sensitive to EDTA and library prep has been observed to experience a 10–20% lower yield when prepping DNA samples provided with higher levels of EDTA. Alternatively, one can substitute either Qiagen Buffer EB (cat# 19086), which is composed of 10 mM Tris pH 8.5, or a low-EDTA buffer such as Teknova DNA Suspension Buffer (cat#T0223), which is composed of 10 mM Tris, 0.1 mM EDTA, pH 8.0 when eluting DNA samples.

Should genomic DNA be treated with RNase during the purification process?

All Kits: The Qiagen DNeasy kits allow an optional step to treat samples with RNase (cat#19101) during the DNA purification process. In contrast, Zymo Research documents that reagents supplied with their DNA purification kits should substantially remove RNA unless an excessive quantity of tissue/sample that exceeds specifications was used during the purification process. It should be anticipated that DNA purified on a spin column (Qiagen or Zymo Research) usually results in samples containing 10–40% RNA. Extended incubation of samples with RNase when using these kits can substantially reduce the amount of RNA recovered. In contrast, purifications strategies that include DNA precipitation (such as the Gentra PureGene kit), often result in 50–90% RNA. Excessive RNA in genomic DNA samples can be inhibitory to downstream enzymatic steps in library preparation as a result of template blocking.

How should I concentrate genomic DNA samples?

All Kits: DNA can be concentrated using a Genomic DNA Clean and Concentrator Kit (cat#D4010) from Zymo Research. This kit enables purification and concentration of up to 10 µg of high molecular weight DNA and elution in a volume as low as 10 µl.

How should I store dilute genomic DNA samples?

All Kits: Dilute genomic DNA samples should be stored at -80°C in either Eppendorf LoBind tubes (cat#022431048) or Axygen Maxymum Recovery tubes (cat#MCT-150-L-C). Both of these products minimize the non-specific binding of DNA to the surface of the plastic tube.

Is phenol/chloroform extraction a recommended method for the purification of genomic DNA?

All Kits: The use of organic extraction reagents such as Trizol or phenol/chloroform as a standalone product for genomic DNA purification is strongly discouraged. The quality of DNA purified with these reagents tends to be lower due to organic carry-over and the co-precipitation of biomolecules, which are inhibitory to downstream enzymatic steps in the library preparation process.

Is purification of genomic DNA using the Gentra Puregene Kit recommended?

All Kits: The use of the Gentra Puregene Kit for DNA purification is discouraged. The quality of DNA purified by this protocol tends to be lower due to carry-over of co-precipitated proteins and other biomolecules in addition to reagents used in the precipitation process. Furthermore, DNA purification using this kit frequently results in samples consisting of 50–90% RNA. Excessive RNA in genomic DNA samples can be inhibitory to downstream enzymatic steps in library preparation as a result of template blocking.

Does the High Throughput Genomics Shared Resource provide DNA purification services?

All Kits: DNA purification services can be obtained from either the Biorepository and Molecular Pathology Shared Resource (contact john.oshea@hci.utah.edu), which supports purification with Qiagen reagents or the Cellular Translational Research Core Facility (contact colin.maguire@utah.edu). If using the Cellular Translation Research Core Facility for purification services, we recommend requesting samples to be purified using either Qiagen, Promega, or Zymo Research reagents, while discouraging preparation with the Gentra Puregene Kit.

Does the NanoDrop provide an accurate measurement for the concentration of a genomic DNA sample?

All Kits: An A260 measurement on a NanoDrop often reflects absorbance by multiple forms of nucleic acids that are present in a sample, including DNA, RNA, short nucleic acid fragments, and nucleotides. Considering that many DNA samples contain 10–90% RNA, this assay often does not accurately reflect the concentration of genomic DNA.

How should I measure the concentration of my genomic DNA sample?

All Kits: The concentration of genomic DNA samples can be accurately measured using either the Qubit dsDNA Broad Range Assay Kit (Fisher cat#32850) or the Qubit dsDNA High Sensitivity Assay (Fisher cat#Q32851), which uses a fluorometric assay to measure double-stranded DNA within a sample.

Does the High Throughput Genomics Shared Resource provide researchers with access to a Qubit instrument?

All Kits: The High Throughput Genomics Shared Resource provides a Qubit 2.0 instrument in the entryway to the laboratory that can be used by university researchers. Reagents required to use this instrument for the measurement of DNA concentration include either the Qubit dsDNA BR Assay Kit (Fisher cat#32850) or the Qubit dsDNA HS Assay Kit (Fisher cat#32851) in addition to Qubit Assay Tubes (Fisher cat#Q32856). These reagents can be purchased from Fisher Scientific.

Do you recommend using saliva as a source for DNA that will be used in whole genome sequencing projects?

All Kits: DNA Genotek, who manufactures the Oragene line of products for genomic DNA purification from saliva, documents that genomic DNA samples purified from human saliva can routinely contain 2–40% bacterial DNA. In contrast, bacterial DNA contribution from buccal swabs (66%) and cytobrushes (88%) is even higher. Therefore, a research lab that plans to use saliva as a source for genomic DNA samples should also plan to sequence the resulting libraries at a higher read-depth as a means to achieve adequate coverage of the human genome that contains a background of bacterial DNA.

What is the average insert size of a DNA library?

Illumina DNA Prep: The average insert size of a library constructed with the Illumina DNA Prep Kit is approximately 350–500 bp.

TruSeq DNA Nano Library Prep Kit: Genomic DNA is mechanically sheared to an average size of 400–500 bp when constructing libraries with the TruSeq DNA Nano Kit. However, the use of this kit for the construction of libraries from DNA samples purified from FFPE tissues tends to result in a reduced insert size (100–400 bp).

TruSeq DNA PCR-Free Library Prep: Genomic DNA is mechanically sheared to an average size of 400–500 bp when constructing libraries with the TruSeq DNA PCR-Free Kit.

NEBNext Ultra II DNA Library Prep Kit: Genomic DNA is mechanically sheared to an average size of 400–500 bp when constructing libraries with the NEBNext Ultra II DNA Library Prep Kit. However, the use of this kit for construction of libraries from cell-free DNA or from DNA samples purified from FFPE tissues tends to result in a reduced insert size (100–400 bp).

Can I construct my own libraries for sequence analysis on an Illumina instrument?

All Kits: Although the High Throughput Genomics Shared Resource offers support for all aspects of the sequencing process for the Illumina platform, we also welcome libraries constructed by individual research labs. Prior to sequencing these libraries, quality control assays will be performed, including a Qubit dsDNA HS Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR using a KAPA Library Quantification Kit (normalization of molarity in preparation for sequencing). Although we highly qualify all libraries that are sequenced on the Illumina platform, we are unable to guarantee the yield of sequence reads when individual researchers construct their own sequencing libraries due to variability in library quality that is outside of our control.

Should I be concerned if adapter dimer products are present in the genomic DNA library that I constructed?

All Kits: Adapter dimer products, which appear as 120–140 bp bands on a DNA ScreenTape Assay, are able to hybridize to Illumina sequencing flow cells more efficiently than library molecules that contain DNA inserts. The researcher should be aware that a disproportionate quantity of adapter-only reads may be present in sequence data derived from libraries containing adapter-dimer products. An Illumina reference suggests that 5% adapter dimer in a sequencing library can result in up to 65% of the sequence reads on a NovaSeq 6000 flow cell being contributed by adapter dimers.

How does the High Throughput Genomics Shared Resource qualify libraries prior to sequencing?

All Kits: Quality control assays are performed to validate libraries prior to sequence analysis on the NovaSeq 6000 and MiSeq instruments. These assays include the following: Qubit dsDNA High Sensitivity Assay (library concentration), Agilent ScreenTape Assay (size distribution), and qPCR with the KAPA Library Quantification Kit for Illumina Platforms (normalize library representation in preparation for pooling). The cost for these quality control assays is included as part of the library preparation process when the High Throughput Genomics Shared Resource constructs the library. Alternatively, an additional fee for library QC is charged per sample when researchers construct libraries within their own lab.

How many sequence reads are recommended for human whole genome sequencing?

All Kits: A quantity of 300 Million read-pairs on a 150 x 150 bp sequence run will deliver 90 billion bases of sequence data, which represents approximately 30x coverage of the human genome.

What sequences should be used to trim adapters from the sequence reads?

Illumina DNA Prep: The following sequence can be used for trimming adapters from the 3’ end of sequence reads in both Read 1 and Read 2 for libraries constructed with the Illumina DNA Prep Kit:

• Read 1 and Read 2: CTGTCTCTTATACACATCT.

TruSeq DNA Nano Library Prep, TruSeq DNA PCR-Free Library Prep, NEBNext Ultra II DNA Library Prep: The following sequences can be used for trimming adapters from the 3’ end of sequence reads originating from libraries constructed with the TruSeq DNA Nano Kit, the TruSeq DNA PCR-Free Kit, and the NEBNext Ultra II DNA Library Prep Kit.

• Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
• Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT)

How long will sequencing data from my genomic DNA libraries be available for download on the GNomEx server?

All Kits: Sequencing data will be available on the GNomEx server for a period of approximately 3–6 months. The Bioinformatics Shared Resource has enabled an option for University of Utah laboratories to migrate sequencing data to Seven Bridges for long-term storage. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu)) for information on creating an account on Seven Bridges if you would like to use this strategy for long-term data storage. Alternatively, researchers can explore other options for data storage.

Does the High Throughput Genomics Shared Resource provide assistance with analysis of sequence data?

All Kits: The High Throughput Genomics Shared Resource does not provide sequence analysis services. Please contact the Bioinformatics Shared Resource (bioinformaticshelp@bio.hci.utah.edu) for assistance.